ID: 1051822274

View in Genome Browser
Species Human (GRCh38)
Location 9:21181736-21181758
Sequence CACCCACCCGTCACATCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051822268_1051822274 14 Left 1051822268 9:21181699-21181721 CCAAGAGAAGAGGCCAGTCTGTC No data
Right 1051822274 9:21181736-21181758 CACCCACCCGTCACATCACCAGG No data
1051822271_1051822274 -10 Left 1051822271 9:21181723-21181745 CCCATTGGTCAACCACCCACCCG No data
Right 1051822274 9:21181736-21181758 CACCCACCCGTCACATCACCAGG No data
1051822267_1051822274 15 Left 1051822267 9:21181698-21181720 CCCAAGAGAAGAGGCCAGTCTGT No data
Right 1051822274 9:21181736-21181758 CACCCACCCGTCACATCACCAGG No data
1051822270_1051822274 1 Left 1051822270 9:21181712-21181734 CCAGTCTGTCTCCCATTGGTCAA 0: 2
1: 2
2: 2
3: 17
4: 171
Right 1051822274 9:21181736-21181758 CACCCACCCGTCACATCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051822274 Original CRISPR CACCCACCCGTCACATCACC AGG Intergenic
No off target data available for this crispr