ID: 1051822280

View in Genome Browser
Species Human (GRCh38)
Location 9:21181743-21181765
Sequence TTCCCTGCCTGGTGATGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 4, 1: 0, 2: 3, 3: 23, 4: 272}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051822280_1051822283 -10 Left 1051822280 9:21181743-21181765 CCGTCACATCACCAGGCAGGGAA 0: 4
1: 0
2: 3
3: 23
4: 272
Right 1051822283 9:21181756-21181778 AGGCAGGGAACCCCTGTCTTGGG No data
1051822280_1051822289 18 Left 1051822280 9:21181743-21181765 CCGTCACATCACCAGGCAGGGAA 0: 4
1: 0
2: 3
3: 23
4: 272
Right 1051822289 9:21181784-21181806 AGCACAGACACCCCCATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051822280 Original CRISPR TTCCCTGCCTGGTGATGTGA CGG (reversed) Intergenic
900163610 1:1236079-1236101 TTCCTTGCCTGGTGGGGTGGGGG - Intergenic
900508943 1:3049085-3049107 TACCGTGCCTGGGAATGTGAAGG + Intergenic
901444372 1:9298850-9298872 TTCCCTGCCTTGTGCGGTGAGGG + Intronic
901477090 1:9497213-9497235 TTCCCTACCTTGTGCGGTGAGGG - Intergenic
902757952 1:18561845-18561867 TTCCCTTGCTGGGAATGTGAGGG + Intergenic
904082820 1:27882671-27882693 TTCACTGCCTTGTGAGGTCAAGG + Exonic
904950103 1:34230622-34230644 TTCCCTGCATCATGAGGTGAAGG + Intergenic
905205561 1:36341066-36341088 TTCCCTGCCTGGGGGTGAGGAGG + Exonic
906287655 1:44598149-44598171 TTTCCTGCCTGGTGATGGGGAGG + Intronic
907534202 1:55134386-55134408 ATCCCTCCCTGGTGTAGTGATGG - Exonic
908141688 1:61191659-61191681 TTCTCAGCCTGGTGATGCCATGG + Intronic
908248134 1:62243936-62243958 TTCCCTGCTGGTTGATGTGGTGG + Intronic
909703461 1:78553155-78553177 TTCCCTGCATGGGGATGAGGGGG - Intergenic
910141024 1:84027922-84027944 TTCCCTGCCATGTGAAGTGTGGG + Intergenic
910514041 1:88037732-88037754 GGCCCTGCCTGGTGATTGGAAGG - Intergenic
911269977 1:95789329-95789351 TTCCTTGCCTGGTAATTGGAAGG - Intergenic
912391685 1:109307249-109307271 CTCCCTCCCTGGTGCTGTGGGGG - Intergenic
913408874 1:118528128-118528150 CTCCCTGCCATGTGATGTGCTGG - Intergenic
917055549 1:170977905-170977927 TTCCCTGCCTGGTGATGAGCAGG + Intronic
917758432 1:178128359-178128381 TTCCCTGGTTTGTGATATGAAGG + Intronic
918041464 1:180916502-180916524 TTTCCTGCCAGGTGCTGTGGTGG + Exonic
920248366 1:204605453-204605475 TCCCCTGCCTGGGGATGGGTGGG + Intergenic
920353454 1:205352896-205352918 TTTCTTGCCTAGTGATGTGCAGG - Intronic
920740290 1:208575469-208575491 TTCCCTTCTGGGTGCTGTGAGGG + Intergenic
923102370 1:230826727-230826749 TTCCCAGCCATGTGATGTGATGG - Intergenic
1065977826 10:30858900-30858922 TTCCCTGCGAAGTGAGGTGATGG - Intronic
1066167181 10:32800328-32800350 CTCCCTGACTGGTAAAGTGAGGG - Intronic
1073783806 10:106866321-106866343 TTCCCTGTCTGGTAATGAGTGGG - Intronic
1073854957 10:107663136-107663158 TTCCCTGACTGGTAGGGTGAGGG + Intergenic
1075541690 10:123319010-123319032 CTCCCTGGCTGGAGGTGTGAAGG - Intergenic
1076358567 10:129870418-129870440 TTCCCGGCCTGGCCCTGTGATGG + Intronic
1076634644 10:131874253-131874275 TTCCCTGGCTGGGGGTGGGAGGG + Intergenic
1077755824 11:5026100-5026122 CTCCCTGCCTAGTGATGAGCAGG - Intergenic
1078490585 11:11764295-11764317 TTCCATGCATGGTGATGGCAGGG + Intergenic
1078993303 11:16670615-16670637 TTCCCTGTCTGGTGACAAGAGGG - Intronic
1079869585 11:25780924-25780946 GGCCCTGCCTGGTGATGAGTGGG - Intergenic
1080568690 11:33536280-33536302 TTCCCTGCCTCATGATGTCTGGG + Intergenic
1081110331 11:39127312-39127334 TTCCCTGACTGGTAGGGTGAGGG + Intergenic
1083340197 11:61954389-61954411 TACTCTGCCTGATGCTGTGATGG - Intronic
1084055398 11:66628667-66628689 TTCTCTGCGTGGTGATGGGGTGG + Intronic
1085054717 11:73396758-73396780 TTCCCTGGCTGCTGAGGTGCAGG - Exonic
1085747428 11:79127146-79127168 CTCCCTGACTGGTAGTGTGAGGG + Intronic
1085804896 11:79626630-79626652 TTTCCTTCCTGTTGATGAGACGG + Intergenic
1086822046 11:91446392-91446414 TGCCCTGCCTGGTGACGAGTTGG - Intergenic
1087495339 11:98884096-98884118 TTCTCTGATTAGTGATGTGAGGG - Intergenic
1087654910 11:100910858-100910880 TTTCTGGCCTGGTGGTGTGAAGG + Intronic
1088336322 11:108708310-108708332 TTTTTAGCCTGGTGATGTGATGG + Intronic
1088730031 11:112671977-112671999 TTCCCTGCCTGGTGATGAACAGG - Intergenic
1091108040 11:132941644-132941666 GGCCCTTCCTGGAGATGTGAAGG - Intronic
1092217723 12:6694578-6694600 TTCCCGGCCTGATGTTGTGGTGG - Exonic
1092579366 12:9821474-9821496 TTCTCTGCTTGGTGATGAGCAGG - Intergenic
1092907700 12:13116954-13116976 TTCCCTGCCTGGGGATCCCAAGG - Intronic
1093240074 12:16659267-16659289 TTCCCTGCCTGGTGATGAGCAGG + Intergenic
1094327018 12:29251640-29251662 TTCCCTGACTTGTGGAGTGAGGG + Intronic
1098267273 12:68735263-68735285 TGCCCTAACTGCTGATGTGAAGG + Exonic
1099661345 12:85567609-85567631 ATCCCTGCCTGGCAATGGGAAGG + Intergenic
1099667709 12:85653394-85653416 TTCCCTGTCTGGTGATGAGTGGG + Intergenic
1099860374 12:88218445-88218467 GTCCCTGCCTGGTGATGAGCAGG - Intergenic
1102101707 12:110283210-110283232 TTCCCTTCCTGGTAATGGCAAGG + Intronic
1102646287 12:114405941-114405963 TTCCCTCCCTGGGGGTGTAAAGG - Intronic
1102806602 12:115786889-115786911 GTCCCTGCCTTGTGGGGTGATGG - Intergenic
1103486965 12:121289534-121289556 TTCCCTGGCAGGTTATGGGATGG - Intronic
1105722860 13:23134467-23134489 TTTCCTTCCTGGAGTTGTGATGG - Intergenic
1107796776 13:44061141-44061163 TTCCCAGACTCCTGATGTGAAGG - Intergenic
1108860676 13:54854623-54854645 TTCCCTTGCTGGTCTTGTGATGG + Intergenic
1109855074 13:68116456-68116478 TTACCTTCCTGGACATGTGAAGG + Intergenic
1110126890 13:71954822-71954844 TGGCCTGCCTGGTAATGGGATGG - Intergenic
1111420113 13:88000329-88000351 GTCCCTGCCTGGTGAAGAGCAGG + Intergenic
1111575893 13:90153872-90153894 TTCCCTGACTGGTAGGGTGAAGG - Intergenic
1111817405 13:93170695-93170717 TTCTCAGCCTGGAGAGGTGATGG + Intergenic
1115491060 14:33958663-33958685 CTCCCTTCATGGGGATGTGACGG - Intronic
1116028219 14:39538662-39538684 TTCCCTGCTTGGTGATGAGCAGG - Intergenic
1116190790 14:41662818-41662840 TTCCCTTCCTTGTGTTGTGCAGG - Intronic
1116799130 14:49424706-49424728 TTACCTGCCTTGTGAGGTGGTGG - Intergenic
1117001446 14:51375198-51375220 CTCCCTGACTGGTAAGGTGAGGG + Intergenic
1120082168 14:80228639-80228661 CTCCCTGCCTGGTAGGGTGAGGG - Intronic
1121415169 14:93774367-93774389 ATGCCTGCCTGGCCATGTGAAGG + Intronic
1124018085 15:25895327-25895349 TTCTTAGCCTGTTGATGTGATGG + Intergenic
1127825286 15:62697583-62697605 TTCCCTGCTTTATGCTGTGAAGG - Intronic
1128562000 15:68674709-68674731 AACCCTGCCTGGTGAGGTCATGG - Intronic
1128565442 15:68697944-68697966 GTCCCTGCCTGCTGAGGTGCTGG + Intronic
1128665691 15:69536788-69536810 TTCCCAGCCTGGGGAAGAGAGGG + Intergenic
1129872835 15:78952068-78952090 TCCCCTTCCTGGCGATGAGAAGG + Intergenic
1130025558 15:80267840-80267862 TTCCCTGGCTGGAGATGGCAGGG - Intergenic
1130748248 15:86680406-86680428 TTCCCTGCCTAGAGATTTTATGG + Intronic
1132761698 16:1511642-1511664 TCCACTGCCAGGTGATGGGAGGG - Intronic
1133030975 16:3011002-3011024 TCACCTGCCTGGTGCTGGGAGGG - Intergenic
1133974025 16:10587502-10587524 TTCCCAGCCTGGAGATTAGAGGG - Intergenic
1134057200 16:11178091-11178113 TACCCTGACTTGTGATATGAGGG - Intronic
1134425998 16:14145790-14145812 TTCCCAGTCTGCTCATGTGAAGG - Intronic
1136397813 16:30002650-30002672 CTCCCTCCCTGGAGATGGGAGGG + Intronic
1137396821 16:48122028-48122050 TTCCCTGCCTGGCCCTGTGCAGG - Intronic
1137885117 16:52094899-52094921 TAGCCTGCTTGGTGCTGTGATGG + Intergenic
1138561832 16:57805589-57805611 GTCCCTGCCTGGGGATGGGGTGG - Intronic
1139868485 16:70083622-70083644 TTGCCTGCTTTGTGATGTTATGG + Intergenic
1140386851 16:74548251-74548273 TTGCCTGCTTTGTGATGTTATGG - Intronic
1140895529 16:79321273-79321295 TCCCCTACCTTGTGGTGTGATGG - Intergenic
1141496894 16:84416633-84416655 TGCCCTGCCTGGAAATCTGAAGG - Intronic
1141874539 16:86813881-86813903 TTCCCTGCCTGCTGGTGGTATGG - Intergenic
1143020050 17:3912749-3912771 CTCCATGCCTGGTGCTGTGCCGG - Intronic
1143119840 17:4599808-4599830 TTCCCAGCTTGGTGGGGTGATGG + Intronic
1144950882 17:18992788-18992810 TTCCCTGCCTGGTGCCGGGCAGG + Intronic
1146091674 17:29885558-29885580 CTCCTTCCCTGGTTATGTGATGG - Intronic
1146687931 17:34854112-34854134 CTGCCAGCCTGGTCATGTGAAGG - Intergenic
1146751867 17:35389320-35389342 ATCCCTGCCTAGTGATGAGCAGG + Intergenic
1147314542 17:39613271-39613293 TCCCCTGCCTGGGGAGGTCAGGG - Intergenic
1148208340 17:45793458-45793480 TTCCCTCCCTGGTGCTGTCCTGG + Intronic
1149992249 17:61389757-61389779 TTCCCTGCACTGTGGTGTGATGG + Intronic
1150599007 17:66633817-66633839 TTGCCTGCCTCCTGGTGTGAAGG + Intronic
1150649994 17:67003869-67003891 TTTGCTGCCTGGAGAGGTGAAGG - Intronic
1151118184 17:71762765-71762787 TTGCCTCCCTGGTGATTGGATGG - Intergenic
1152036722 17:77877972-77877994 GTCCCTGCCTGGGGCTCTGAGGG + Intergenic
1152278538 17:79372136-79372158 TGCGCTGCCCGGTGCTGTGAGGG + Intronic
1152334988 17:79695623-79695645 ATCCCTGCCTGCTGTTGTCATGG - Intergenic
1152735560 17:81995355-81995377 CTCCCTGGCTGGGGCTGTGACGG + Intronic
1153506994 18:5810916-5810938 TTCCCTGGCTTGTGAAGTGGTGG - Intergenic
1155021346 18:21899933-21899955 CTCCCTGCCTAGTGTTATGACGG - Intergenic
1155576985 18:27259115-27259137 TTCCCTGTCTGGTAATGAGTAGG + Intergenic
1156648254 18:39193851-39193873 TTTCCTGACTGGGGAAGTGAAGG - Intergenic
1156666366 18:39412641-39412663 TTCCATGCTTGCTGGTGTGATGG + Intergenic
1158042059 18:53106355-53106377 TTGCCTGCCTGGTACTGGGAAGG + Intronic
1159991914 18:74918933-74918955 AGCCCTGCCTGGAGATGGGAGGG + Intronic
1160553033 18:79707209-79707231 TACCCTGCCTGCTGGTGTGACGG - Intronic
1161213090 19:3078141-3078163 TTACCTGGGTGGAGATGTGATGG - Intergenic
1162218064 19:9152784-9152806 TTCCATGGATGGTGAGGTGAGGG - Intronic
1164541910 19:29127876-29127898 CTGCCTGCCTGGTGTTGTGGTGG - Intergenic
1164772207 19:30818190-30818212 TGCCATGCCTGGTGATTTGTTGG - Intergenic
1166634107 19:44434284-44434306 TTGCCTACCTGGTGATGGAAGGG - Intronic
1166965894 19:46529154-46529176 TCCCCAGCCTGGTGATCTGCTGG - Intronic
1167042132 19:47028454-47028476 TTCGCCGCCTGGTGTTTTGATGG + Intronic
1167100093 19:47399309-47399331 TCCCCTGCCTGGTGCTGGGAAGG - Intergenic
925289036 2:2734376-2734398 TGCCCTGCAGGCTGATGTGAGGG - Intergenic
926810531 2:16751777-16751799 CTCCCTGACTGGTGAGGTGAGGG - Intergenic
926928318 2:18010765-18010787 TTTCCTGCCTGATGAGCTGAGGG + Intronic
928096280 2:28407045-28407067 TCCCCTGACTGGTGAGGTGTGGG - Intronic
928694324 2:33833747-33833769 ATCCCTGCCAGGTCATGGGAGGG + Intergenic
929961231 2:46497799-46497821 TGCCCTGGCTGGTGAGGAGAGGG + Intronic
930974192 2:57435175-57435197 TTCCCTGCCTAGTGATTTTGTGG - Intergenic
931629627 2:64287132-64287154 TTACCTCCAGGGTGATGTGAGGG + Intergenic
932076001 2:68663459-68663481 TTCCCTGACTGGTGTAGTGCTGG + Intergenic
932779826 2:74553281-74553303 TTCCCTGCCTGGGAATCTGCTGG - Intronic
937006853 2:118524527-118524549 TTCCCTGACCTGTGAAGTGAGGG + Intergenic
937215076 2:120307501-120307523 TTCCCTGGCAGGTGATTGGAAGG + Intergenic
937397229 2:121547397-121547419 TTCCCTGCCTGGTGAAGAGTAGG - Intronic
937415018 2:121707628-121707650 ATACCTGCCTGGTGATGTGTTGG + Intergenic
937800195 2:126073614-126073636 CTCCCTGACTGGTAAGGTGAGGG + Intergenic
939867435 2:147488632-147488654 ATCCCAGCCTGGGGAGGTGAAGG - Intergenic
940707915 2:157126887-157126909 TTCCCTGCCTGGTGACAAGTAGG - Intergenic
941366792 2:164620108-164620130 TTCTATGCCTGGTGATTTAAAGG - Intronic
944929563 2:204502165-204502187 TTCCTTTCCTGATGATCTGAAGG + Intergenic
946794701 2:223337916-223337938 ATCCCTGCCTGATGAAGTTAAGG + Intergenic
948912736 2:241012465-241012487 TTCCCTCCCTGGTGTTTTTAGGG + Intronic
1169274351 20:4223457-4223479 CTCCCTGCCAGGTGCTGTGCTGG + Intronic
1169573147 20:6927981-6928003 TTGCCTGCCTTTTGATGTTAGGG + Intergenic
1170928387 20:20746185-20746207 TCCCCTGCCTGGGGGTGGGATGG - Intergenic
1173938474 20:46889586-46889608 TTTCCTGCATGGTGTTTTGATGG + Intergenic
1175021604 20:55857034-55857056 TTCACTGCCAGCTGAGGTGATGG - Intergenic
1177002752 21:15634648-15634670 CTCCCTGACTGGTAGTGTGAGGG - Intergenic
1177950859 21:27535272-27535294 TTGCTTTCCTGGTGATCTGAAGG + Intergenic
1178896801 21:36565479-36565501 TTCCTTTCCTGGTGTTGTGCTGG + Intronic
1178917938 21:36719424-36719446 TTCCCTTGCTGGCGATCTGAGGG - Intronic
1179899212 21:44380161-44380183 TTCTCTGACTGGTGATTTGTGGG + Intronic
1180050071 21:45327033-45327055 TTTGCTGCCTGGTGAGGTGTGGG + Intergenic
1181173944 22:21025594-21025616 TTCCCTGCCTGCTGAGAGGACGG - Intronic
1181349201 22:22243413-22243435 TTCTCTGCCTGGTGAGGTGCAGG - Intergenic
1183418018 22:37693765-37693787 TTCCCAGCCTGGAGCTGGGAAGG + Intronic
1184390077 22:44198802-44198824 TTCACTTCCAGGTGAAGTGAAGG + Intronic
1184776308 22:46625224-46625246 TTCCCAGCATGGTGAGGGGAGGG - Intronic
949170175 3:987701-987723 TTCCCTGACTGGTAGGGTGAGGG - Intergenic
949245733 3:1923816-1923838 CTCCCTGACTGGTAGTGTGAGGG + Intergenic
951299355 3:20975095-20975117 CTCCCTGCTTGGGGCTGTGAGGG - Intergenic
951978696 3:28542560-28542582 TTCCCTAACTTGTGCTGTGAGGG + Intergenic
955557911 3:60157914-60157936 TTCCCTGAATGGTGATGAGATGG + Intronic
956030640 3:65033625-65033647 TTCCCTGCCAGGAGAGGTGTTGG - Intergenic
957873526 3:86116003-86116025 TACCCTGCATGGGTATGTGAAGG + Intergenic
957874483 3:86128229-86128251 TTCCCTGACTGGTGGAGTGAGGG + Intergenic
959869420 3:111309604-111309626 TTCCTTTACTGATGATGTGATGG + Intronic
960832095 3:121860744-121860766 TTCTTTGACTGGTGATGTTACGG + Intronic
960871945 3:122258930-122258952 TGCCCTGCCGGGTGAGGTCATGG + Intronic
961443511 3:126966950-126966972 TCCCTTGCCTGGTGATGGGGTGG + Intergenic
962067631 3:131998571-131998593 TTTCCTGTCTTGTCATGTGAAGG - Intronic
963453578 3:145515992-145516014 TTCCCTGACTGCTAAGGTGAGGG + Intergenic
963545880 3:146658146-146658168 CTCCCTGCTTGGGGTTGTGAGGG + Intergenic
965226897 3:166001873-166001895 CTCCCTGACTGGTAAGGTGAGGG - Intergenic
968600227 4:1505223-1505245 TGCCCTGCCTCCTGATGTCATGG + Intergenic
968730147 4:2265685-2265707 TTCCCTCCCTGGGTGTGTGAGGG - Intergenic
969297452 4:6278297-6278319 GTTCCTGGGTGGTGATGTGAGGG + Intronic
969533409 4:7741578-7741600 AGCCCTGGCTGGTGATGTGCTGG + Exonic
970567613 4:17347840-17347862 TTCCATCTCTGGTGATCTGATGG + Intergenic
970859671 4:20687483-20687505 TTCCCTGGCCTGTGAAGTGAGGG - Intergenic
973001822 4:44961329-44961351 TTCTCTGCATGGGGATTTGAGGG + Intergenic
973130329 4:46640791-46640813 TTCCCTGACTGGTAAGGTGAGGG - Intergenic
975276295 4:72505717-72505739 TTCCCTGCCTGGAGATGGCAGGG + Intronic
975940932 4:79644667-79644689 TTCCCTGGATGGTGATGTATGGG + Intergenic
977784750 4:101019716-101019738 TTTTCTCCCTGGTGATATGAAGG - Intergenic
977819882 4:101458899-101458921 TTCCTTGTCTGGTGATGAGTTGG - Intronic
979595856 4:122533245-122533267 TTCCCTGACCTGTGAAGTGAGGG - Intergenic
981173206 4:141648931-141648953 CTCCCTGCCAAGTGCTGTGAAGG + Intronic
983281875 4:165691046-165691068 TTCCCTGTCTGGAGAAGTAAAGG - Intergenic
983579712 4:169295728-169295750 TTCTTTGCTTGTTGATGTGATGG - Intergenic
985056245 4:186037915-186037937 TTCCCAGCCAGGGGATGGGAAGG + Intergenic
985225988 4:187762608-187762630 TTCCCTGACCTGTGAAGTGAGGG - Intergenic
986202759 5:5592815-5592837 TCCGCTGCCTGGTTATGTGGTGG + Intergenic
986735667 5:10665747-10665769 GTACCTGCCTGATGATCTGAGGG + Intergenic
987511805 5:18848804-18848826 TTCCCCGCCTGGTGTTCTCACGG - Intergenic
988641568 5:33046280-33046302 TTCCCTGACTCATGAAGTGAGGG + Intergenic
990276358 5:54201305-54201327 TTCCTTTCATGGTGATGTGGTGG - Intronic
990341769 5:54830408-54830430 TTCCCTGAGTGATGATGAGAGGG - Intergenic
992242736 5:74788334-74788356 CTCCCTGACTGGTGGGGTGAGGG + Intronic
993225559 5:85164828-85164850 GTCCCTGCCTGGTGAAGAGTGGG + Intergenic
993232038 5:85248651-85248673 CTCCCTAACTGGTAATGTGAGGG - Intergenic
994291511 5:98033076-98033098 CTCCCTGACTGGTTAGGTGAGGG - Intergenic
994958331 5:106563337-106563359 CTCCCTGACTGGTGGGGTGAGGG + Intergenic
994969832 5:106721213-106721235 TTCCTTGTGTGTTGATGTGATGG - Intergenic
995527611 5:113063061-113063083 TGACCTGCCTGGTGATAAGAGGG - Intronic
996605106 5:125312749-125312771 TTCCCTGCCTTGATATGTGGGGG + Intergenic
997335348 5:133104849-133104871 CTCCCTGCCTGGTGTGGGGATGG + Exonic
997537229 5:134632411-134632433 TTCCTTACCTGGTAAGGTGAAGG - Intronic
997733336 5:136196037-136196059 TTTCCTGCCCGGGGATGTGCAGG - Intergenic
1001271387 5:170314819-170314841 TTCCCTGGCTGGTGAGCTTAGGG + Intergenic
1001999184 5:176187662-176187684 GTCACTGCCAGGTGATGTGGAGG - Intergenic
1002387037 5:178875962-178875984 GTCCCTGCCTGGTGAAGAGTTGG + Intronic
1002451265 5:179320119-179320141 TGCCCTGCCTGGTGAGGGAAGGG + Intronic
1002836914 6:872745-872767 TTCCCTGAATGGTGACGTCAGGG + Intergenic
1002928376 6:1618184-1618206 CTCCCTGCCTGGGGTTGGGAGGG + Intergenic
1003696047 6:8407249-8407271 CTCCCTGACTGGTAAGGTGAGGG - Intergenic
1003758469 6:9148968-9148990 TTCCCTGGCTGGTAGGGTGATGG + Intergenic
1004125764 6:12871662-12871684 CCCCCTGTTTGGTGATGTGAAGG + Intronic
1008173262 6:48234835-48234857 TTCCCTCTCTGGTGATGAGCAGG - Intergenic
1008211482 6:48729759-48729781 TTCCCTGTCTGGTGATGATCAGG - Intergenic
1008820227 6:55623815-55623837 TTCCCTGACTGGTAGAGTGAGGG - Intergenic
1009490885 6:64289298-64289320 TTCTCAGCCTGGTAATGTGTGGG - Intronic
1011752400 6:90466258-90466280 ATCCCTGCCGGTGGATGTGATGG - Intergenic
1012344448 6:98169217-98169239 TTCCCTGACTGGTAGAGTGAGGG + Intergenic
1013354684 6:109336406-109336428 TTCCCTGGGTTGTGATGTGATGG + Intergenic
1016120045 6:140333770-140333792 CTCCCTGACTGGTAAGGTGAGGG - Intergenic
1016288389 6:142500339-142500361 CTCCCGGCCAGGTGATGGGAAGG - Intergenic
1017522854 6:155216963-155216985 TTCATTGCCTGGGGATGAGAGGG + Intronic
1018389181 6:163329761-163329783 TTTCCTTCCAGGTGGTGTGAGGG + Intergenic
1018449486 6:163893842-163893864 TTACCTGCCTGTTGATTTCAAGG + Intergenic
1018887721 6:167955360-167955382 TTCCCTCCTTGGTGATTGGAAGG + Intronic
1019803812 7:3107843-3107865 CTTCCTGCCTGGGGATGAGAGGG + Intergenic
1021305228 7:19023623-19023645 TTCCCTGACCTGTGAAGTGAGGG - Intronic
1024165357 7:46724376-46724398 TGCCCTGCCTGGTGAAGAGTGGG - Intronic
1027173848 7:75890871-75890893 TGCCCTGTCTGGGGATGGGAGGG - Intergenic
1027948386 7:84780425-84780447 CTCCTCGCCTGCTGATGTGAGGG - Intergenic
1029284397 7:99455963-99455985 TTCCCTGGCAGGAGATGGGAGGG - Intronic
1030374941 7:108744482-108744504 TTCCCTGCCTGGTGATGAAAAGG + Intergenic
1032364342 7:131285251-131285273 TTCCCTGAGGAGTGATGTGAAGG + Intronic
1033356850 7:140607179-140607201 TTCCCTGCTAGGTGATGGGATGG + Intronic
1034880546 7:154759311-154759333 TTAATTGCCTGCTGATGTGAAGG - Intronic
1035967809 8:4213763-4213785 TTCCCTGCCAGCTGTGGTGAGGG + Intronic
1036452715 8:8882772-8882794 ATCCCTCCCTGCTGAAGTGAAGG + Intronic
1040512277 8:48105812-48105834 CTCCCTGCAAGGTGAGGTGATGG + Intergenic
1040666029 8:49634290-49634312 TTCCATGCATGGTGACGTGGGGG + Intergenic
1042679371 8:71364847-71364869 ATACCTGCCTGGTTATATGAAGG + Intergenic
1043245643 8:77996693-77996715 TTTACAGCCTGTTGATGTGATGG - Intergenic
1044551913 8:93521955-93521977 TACCCTGCTAGGTGCTGTGAGGG - Intergenic
1044620645 8:94187882-94187904 TTCCCTGACTGGAGAGGTGGAGG + Intronic
1045067165 8:98459446-98459468 TTTGCAGCCTGATGATGTGATGG + Intronic
1047420545 8:124704554-124704576 TTCCCTGCTTGGTGTTGTTTGGG - Intronic
1048843964 8:138589261-138589283 TGCCCGGCCGGGTAATGTGAAGG - Exonic
1049601841 8:143511604-143511626 CTCCCAGCCTGCTGATGGGAGGG + Intronic
1050278285 9:4023299-4023321 TTCCCTGCCTAATGCTGTGTTGG - Intronic
1050430090 9:5553416-5553438 TTTCCTGCCTGGTTAAGTGTAGG + Intronic
1050878786 9:10674457-10674479 AGCCCTGCCTGGTGATGAGTGGG + Intergenic
1051822280 9:21181743-21181765 TTCCCTGCCTGGTGATGTGACGG - Intergenic
1051823510 9:21193801-21193823 TTCCCTGCCTGGTGATGTGAGGG - Intergenic
1051825333 9:21212339-21212361 TTCCCTGCCTGGTGATGTGAGGG - Intronic
1051827310 9:21234399-21234421 TTCCCTGCCTGGTGATGTGAGGG - Intronic
1051882000 9:21849547-21849569 CTCCCTGACTGGTAAAGTGATGG + Intronic
1051966316 9:22833482-22833504 CTCCCTGTCTGGTAAGGTGAGGG + Intergenic
1053136809 9:35656132-35656154 CTGCCTGCCTGGTGAAGTCATGG + Intergenic
1053365300 9:37518483-37518505 TTTCCTGACTGGTGGTGTCAGGG - Intronic
1053425158 9:38005508-38005530 ATCACTGCCTGGTGATGCAAGGG - Intronic
1055334848 9:75223434-75223456 ATCCCTCCCTGGTGCTGTCATGG - Intergenic
1055430125 9:76234976-76234998 TTCCCAGGTTGCTGATGTGAAGG - Intronic
1056111147 9:83396287-83396309 TTCCCAGCCTGGTGTTGTTGTGG - Intronic
1059403035 9:114082336-114082358 CTCCATGACTGGTGATGTGGAGG + Intergenic
1060368250 9:123042233-123042255 TTCCCTGCCTGGTCACTTTAAGG + Intronic
1060639666 9:125227956-125227978 TCCCCGGCATGGTCATGTGATGG + Exonic
1061093751 9:128442219-128442241 TTCCCTGTCTGCTGAAGTCAGGG + Intergenic
1062331361 9:136046253-136046275 GTCCCTGCCTGGCGTTGTCAGGG - Intronic
1062501029 9:136852147-136852169 TGCCCTGCCTGGTGAAGGGGAGG - Intronic
1062589565 9:137267288-137267310 TCCTCTGCTTGGTGATGTGCAGG - Exonic
1185547947 X:960872-960894 TTCCCTGCCTGGTGAAATTAAGG - Intergenic
1187474763 X:19601227-19601249 TTTCCTTCCTGGTAATGTAAAGG - Intronic
1189176294 X:38960628-38960650 CTCCCTGCCTGGGAATATGAGGG + Intergenic
1189402526 X:40684982-40685004 TTCCCAGCATGATCATGTGAGGG + Intronic
1192438189 X:71155370-71155392 TTCCCTGCCTGGTGCCTGGAAGG + Intronic
1193330671 X:80232526-80232548 GGCCCTGCCTGGTGAAGAGATGG + Intergenic
1193496463 X:82219461-82219483 GTCCCTGCCTGGTGAAGAGTGGG + Intergenic
1193549932 X:82879296-82879318 AGCCCTGCCTGGTGAAGTGCTGG - Intergenic
1193752710 X:85365923-85365945 TTCCCTGCCTGGTAATGAGCAGG + Intronic
1194922545 X:99784307-99784329 TTCTATGCCAGGTGCTGTGAAGG - Intergenic
1195208199 X:102625157-102625179 GGCCCTGCCTGGTGAAGAGAGGG + Intergenic
1195782500 X:108480978-108481000 ATCCCTGACTGGTAAGGTGAGGG - Intronic
1195856476 X:109338049-109338071 CTCCCTGCCTGGTGATGGAGGGG + Intergenic
1196152616 X:112391993-112392015 TTCCCTGTCTGGTGATGAGCAGG + Intergenic
1196241314 X:113346148-113346170 TTCCCTGTCTGGTGATGAGCAGG + Intergenic
1199362931 X:146943649-146943671 CTCCGGGCCTGTTGATGTGAGGG + Intergenic
1199721334 X:150544626-150544648 GGCCCTGGCTGGTGAGGTGACGG + Intergenic