ID: 1051822283

View in Genome Browser
Species Human (GRCh38)
Location 9:21181756-21181778
Sequence AGGCAGGGAACCCCTGTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051822271_1051822283 10 Left 1051822271 9:21181723-21181745 CCCATTGGTCAACCACCCACCCG No data
Right 1051822283 9:21181756-21181778 AGGCAGGGAACCCCTGTCTTGGG No data
1051822279_1051822283 -9 Left 1051822279 9:21181742-21181764 CCCGTCACATCACCAGGCAGGGA No data
Right 1051822283 9:21181756-21181778 AGGCAGGGAACCCCTGTCTTGGG No data
1051822272_1051822283 9 Left 1051822272 9:21181724-21181746 CCATTGGTCAACCACCCACCCGT No data
Right 1051822283 9:21181756-21181778 AGGCAGGGAACCCCTGTCTTGGG No data
1051822276_1051822283 -6 Left 1051822276 9:21181739-21181761 CCACCCGTCACATCACCAGGCAG No data
Right 1051822283 9:21181756-21181778 AGGCAGGGAACCCCTGTCTTGGG No data
1051822270_1051822283 21 Left 1051822270 9:21181712-21181734 CCAGTCTGTCTCCCATTGGTCAA 0: 2
1: 2
2: 2
3: 17
4: 171
Right 1051822283 9:21181756-21181778 AGGCAGGGAACCCCTGTCTTGGG No data
1051822273_1051822283 -2 Left 1051822273 9:21181735-21181757 CCACCCACCCGTCACATCACCAG No data
Right 1051822283 9:21181756-21181778 AGGCAGGGAACCCCTGTCTTGGG No data
1051822275_1051822283 -5 Left 1051822275 9:21181738-21181760 CCCACCCGTCACATCACCAGGCA No data
Right 1051822283 9:21181756-21181778 AGGCAGGGAACCCCTGTCTTGGG No data
1051822280_1051822283 -10 Left 1051822280 9:21181743-21181765 CCGTCACATCACCAGGCAGGGAA 0: 4
1: 0
2: 3
3: 23
4: 272
Right 1051822283 9:21181756-21181778 AGGCAGGGAACCCCTGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051822283 Original CRISPR AGGCAGGGAACCCCTGTCTT GGG Intergenic
No off target data available for this crispr