ID: 1051822289

View in Genome Browser
Species Human (GRCh38)
Location 9:21181784-21181806
Sequence AGCACAGACACCCCCATTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051822280_1051822289 18 Left 1051822280 9:21181743-21181765 CCGTCACATCACCAGGCAGGGAA 0: 4
1: 0
2: 3
3: 23
4: 272
Right 1051822289 9:21181784-21181806 AGCACAGACACCCCCATTCCAGG No data
1051822286_1051822289 -7 Left 1051822286 9:21181768-21181790 CCTGTCTTGGGCCCACAGCACAG 0: 5
1: 46
2: 70
3: 99
4: 295
Right 1051822289 9:21181784-21181806 AGCACAGACACCCCCATTCCAGG No data
1051822279_1051822289 19 Left 1051822279 9:21181742-21181764 CCCGTCACATCACCAGGCAGGGA No data
Right 1051822289 9:21181784-21181806 AGCACAGACACCCCCATTCCAGG No data
1051822281_1051822289 7 Left 1051822281 9:21181754-21181776 CCAGGCAGGGAACCCCTGTCTTG 0: 3
1: 3
2: 23
3: 59
4: 212
Right 1051822289 9:21181784-21181806 AGCACAGACACCCCCATTCCAGG No data
1051822284_1051822289 -5 Left 1051822284 9:21181766-21181788 CCCCTGTCTTGGGCCCACAGCAC 0: 5
1: 30
2: 56
3: 79
4: 332
Right 1051822289 9:21181784-21181806 AGCACAGACACCCCCATTCCAGG No data
1051822285_1051822289 -6 Left 1051822285 9:21181767-21181789 CCCTGTCTTGGGCCCACAGCACA 0: 5
1: 52
2: 58
3: 85
4: 294
Right 1051822289 9:21181784-21181806 AGCACAGACACCCCCATTCCAGG No data
1051822276_1051822289 22 Left 1051822276 9:21181739-21181761 CCACCCGTCACATCACCAGGCAG No data
Right 1051822289 9:21181784-21181806 AGCACAGACACCCCCATTCCAGG No data
1051822275_1051822289 23 Left 1051822275 9:21181738-21181760 CCCACCCGTCACATCACCAGGCA No data
Right 1051822289 9:21181784-21181806 AGCACAGACACCCCCATTCCAGG No data
1051822273_1051822289 26 Left 1051822273 9:21181735-21181757 CCACCCACCCGTCACATCACCAG No data
Right 1051822289 9:21181784-21181806 AGCACAGACACCCCCATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051822289 Original CRISPR AGCACAGACACCCCCATTCC AGG Intergenic
No off target data available for this crispr