ID: 1051822938

View in Genome Browser
Species Human (GRCh38)
Location 9:21190368-21190390
Sequence CCCGTTGAGCACATTTACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051822935_1051822938 -6 Left 1051822935 9:21190351-21190373 CCTATGTACCAAACTTGCCCGTT No data
Right 1051822938 9:21190368-21190390 CCCGTTGAGCACATTTACCCTGG No data
1051822934_1051822938 13 Left 1051822934 9:21190332-21190354 CCAACATGGCACATGTATACCTA 0: 1249
1: 14313
2: 20572
3: 9744
4: 5699
Right 1051822938 9:21190368-21190390 CCCGTTGAGCACATTTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051822938 Original CRISPR CCCGTTGAGCACATTTACCC TGG Intergenic
No off target data available for this crispr