ID: 1051824408

View in Genome Browser
Species Human (GRCh38)
Location 9:21203605-21203627
Sequence CTGAGTCCTTAAATGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051824404_1051824408 -6 Left 1051824404 9:21203588-21203610 CCTCGGCCCTATAGATACTGAGT No data
Right 1051824408 9:21203605-21203627 CTGAGTCCTTAAATGGAATGAGG No data
1051824402_1051824408 19 Left 1051824402 9:21203563-21203585 CCTGAACTCTGGCAAAGTTAGTT No data
Right 1051824408 9:21203605-21203627 CTGAGTCCTTAAATGGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051824408 Original CRISPR CTGAGTCCTTAAATGGAATG AGG Intergenic
No off target data available for this crispr