ID: 1051824813

View in Genome Browser
Species Human (GRCh38)
Location 9:21209405-21209427
Sequence CCTGGAGTCTTGCTTAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 3, 1: 0, 2: 1, 3: 19, 4: 226}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051824813_1051824823 23 Left 1051824813 9:21209405-21209427 CCTGCCCTAAGCAAGACTCCAGG 0: 3
1: 0
2: 1
3: 19
4: 226
Right 1051824823 9:21209451-21209473 AGTGTGGAGCTGGTCCAGGAGGG No data
1051824813_1051824822 22 Left 1051824813 9:21209405-21209427 CCTGCCCTAAGCAAGACTCCAGG 0: 3
1: 0
2: 1
3: 19
4: 226
Right 1051824822 9:21209450-21209472 CAGTGTGGAGCTGGTCCAGGAGG No data
1051824813_1051824818 7 Left 1051824813 9:21209405-21209427 CCTGCCCTAAGCAAGACTCCAGG 0: 3
1: 0
2: 1
3: 19
4: 226
Right 1051824818 9:21209435-21209457 GCTGCTGATGAAATCCAGTGTGG No data
1051824813_1051824819 13 Left 1051824813 9:21209405-21209427 CCTGCCCTAAGCAAGACTCCAGG 0: 3
1: 0
2: 1
3: 19
4: 226
Right 1051824819 9:21209441-21209463 GATGAAATCCAGTGTGGAGCTGG No data
1051824813_1051824820 19 Left 1051824813 9:21209405-21209427 CCTGCCCTAAGCAAGACTCCAGG 0: 3
1: 0
2: 1
3: 19
4: 226
Right 1051824820 9:21209447-21209469 ATCCAGTGTGGAGCTGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051824813 Original CRISPR CCTGGAGTCTTGCTTAGGGC AGG (reversed) Intronic
900231743 1:1562522-1562544 CCAGGAGTCTGGTTTAGGGCTGG - Intronic
900231758 1:1562599-1562621 CCAAGAGTCTGGTTTAGGGCTGG - Intronic
900425909 1:2578526-2578548 CCTGGAATGTTGCTTAGGGGAGG - Intergenic
900513685 1:3071561-3071583 CCTGCCTTCTTGCTCAGGGCAGG - Intronic
900687853 1:3959975-3959997 CCTGGATTCTAGCACAGGGCTGG + Intergenic
901628311 1:10635865-10635887 CCTGGAGTCCAGCTCAGGGAGGG + Intergenic
901808996 1:11755224-11755246 CCTGGAGCCTGGCTTTGGGCTGG + Intergenic
903014949 1:20355669-20355691 CCTCGAGTCTTCCTGAGGCCGGG - Intergenic
903220390 1:21865933-21865955 CCTGGCCTCTTGGTTTGGGCAGG - Intronic
903285215 1:22272748-22272770 CCTTGGGTCCTGCGTAGGGCAGG + Intergenic
903490942 1:23728030-23728052 CCTGGACTCTTGTTTAGGTTTGG + Intergenic
904600744 1:31671385-31671407 CCTGCGGTCCTGCTTAGGGGAGG - Intronic
905868229 1:41387885-41387907 CCTGGAGTCTTCACTGGGGCAGG - Intergenic
906052663 1:42887779-42887801 TCTGTTGTCTTGCTGAGGGCGGG + Intergenic
906196118 1:43931830-43931852 CCTGGAGTCTTGGATTGGGGTGG - Intergenic
907525468 1:55051398-55051420 CCTGAAGTCTTCCTTTGGCCTGG + Intronic
907753915 1:57290971-57290993 TCTGGAGTCTTTCTTGGCGCTGG + Exonic
911492635 1:98589018-98589040 CATGGAGTCTTGCTGATTGCTGG + Intergenic
912474616 1:109927681-109927703 CCTGGAGACCACCTTAGGGCTGG - Intronic
915751325 1:158213302-158213324 CCTGGAGTCTGGCTGAGTCCAGG - Intergenic
917098673 1:171424701-171424723 CCTGAAGGCTCGCCTAGGGCAGG + Intergenic
917871875 1:179249360-179249382 CCTCTGGTCTTCCTTAGGGCGGG - Intergenic
919985587 1:202671816-202671838 CCTGGGGGCATTCTTAGGGCAGG - Intronic
922784283 1:228275480-228275502 CCTGGCGTCTTGTTCAGAGCAGG + Intronic
1063010023 10:2012442-2012464 CCTGGAGTCCTGCTGGGGGACGG + Intergenic
1063106111 10:2993768-2993790 CCTGGTGACTTCCTCAGGGCGGG + Intergenic
1063219802 10:3956399-3956421 GGTGGAGTCTGCCTTAGGGCAGG + Intergenic
1063364121 10:5479681-5479703 CCTGGTGCCTTGCTGTGGGCGGG - Intergenic
1063613008 10:7579227-7579249 CTTAAAATCTTGCTTAGGGCCGG + Intronic
1064444198 10:15379151-15379173 CCTGCACTCTTGCTGAGGCCAGG + Intergenic
1065407893 10:25389254-25389276 CCTTGAGTCTGGCTGAGTGCAGG - Intronic
1073242601 10:102067832-102067854 CCTGGAGGCTTGCTTGGGACTGG + Exonic
1074283017 10:112070846-112070868 CCTGGAGGCTGACTTAGGACAGG + Intergenic
1076166058 10:128283817-128283839 ACTGGAGCCTGGCTTAGGGTAGG - Intergenic
1076699505 10:132264110-132264132 CATGGAGTCTCCCTTAGGGCTGG + Intronic
1077884739 11:6378683-6378705 GCTGGAGTCTTCTGTAGGGCAGG + Intergenic
1081523236 11:43903362-43903384 ACAGGAGTCTTACTAAGGGCAGG - Intronic
1081676779 11:44974571-44974593 CCTGGAGTCTGGCTCAGCCCTGG - Intergenic
1081843092 11:46217686-46217708 TCTGGAGGCTTGACTAGGGCAGG - Intergenic
1083301068 11:61739841-61739863 CCTGGAGTCCTGCTCAGGGCTGG - Intronic
1084697180 11:70762696-70762718 CCTAGTGTCTACCTTAGGGCAGG + Intronic
1085516888 11:77116715-77116737 CCTGGAGGCAGGCTGAGGGCAGG - Intronic
1087199875 11:95334697-95334719 CCAGGAGTCATGGTGAGGGCAGG + Intergenic
1088267340 11:108000525-108000547 CCTGTGGATTTGCTTAGGGCCGG - Intergenic
1088586775 11:111366691-111366713 CCTGGTGGCTTGCCTAGGTCTGG - Intronic
1088688902 11:112308156-112308178 CCTAGAGCCTTGCTCATGGCTGG - Intergenic
1089732595 11:120528469-120528491 ACTGGAGGCTGGCTGAGGGCAGG + Intronic
1089733759 11:120535470-120535492 CCTGGAGCAGTGCTGAGGGCAGG + Intronic
1090214678 11:124951411-124951433 TCTGAAGACTTGATTAGGGCTGG + Intergenic
1091582820 12:1799307-1799329 CCCGGAGTCCCGCTGAGGGCTGG + Intronic
1094209213 12:27873069-27873091 CCTAGAGTCTTGTACAGGGCTGG + Intergenic
1094443513 12:30505415-30505437 CCTGGAGTCCTGCTGAGGAAGGG - Intergenic
1096666184 12:53167180-53167202 CATGGATACTTGCTTGGGGCTGG - Intronic
1097976911 12:65696345-65696367 CCTGGAGTATTCCTCAGGGCAGG + Intergenic
1099085863 12:78245067-78245089 ACTGGAGTCTTGCTTTGAGATGG + Intergenic
1102043906 12:109817731-109817753 TCTGGAGTCATGATGAGGGCTGG - Intronic
1102454634 12:113063937-113063959 CCTGGGCTCTAGCTTAGGACTGG - Intronic
1103648169 12:122411740-122411762 CCTGGCCTCCTGCCTAGGGCTGG + Intronic
1104723445 12:131060101-131060123 CTTGGAGTCCTGGTGAGGGCTGG + Intronic
1105206117 13:18226025-18226047 ACAGCAGTATTGCTTAGGGCTGG - Intergenic
1106740701 13:32638048-32638070 CCTGGTGATTTGGTTAGGGCTGG + Intronic
1106942585 13:34794497-34794519 ACTGGATTCTTGCTGAAGGCAGG - Intergenic
1107416488 13:40206058-40206080 CCTGGAATCGTGCTCAGGCCAGG - Intergenic
1111984346 13:95050503-95050525 TCTGGTGTCTTTCTTAGGTCAGG + Intronic
1113804156 13:113103833-113103855 CCTGGAACCTTGCCTGGGGCTGG - Intergenic
1114651534 14:24287854-24287876 CCTGGTGTCTTGCATGGGGCTGG + Intergenic
1114873425 14:26686115-26686137 CATGGTGTCTTGCACAGGGCAGG + Intergenic
1117285466 14:54282461-54282483 CCTGGAGTCTAGCTGAGTCCAGG + Intergenic
1119266476 14:73265607-73265629 CCTGGAGTCCGGCTCAGGACTGG - Intronic
1119410592 14:74427558-74427580 CCTGGGGTCTGTCTCAGGGCTGG + Intergenic
1119711917 14:76828571-76828593 CCTGGAGTCCTCCTCCGGGCTGG + Intronic
1119769271 14:77210351-77210373 CATGGAGATTTGCTTAAGGCTGG - Intronic
1120543100 14:85776030-85776052 CCTGTAGTCTTGCTGAGTTCAGG - Intergenic
1121043987 14:90774692-90774714 CCTGGAGTGCGGCTTAGGGAAGG - Intronic
1123125846 14:105945410-105945432 ACTGGAGTCATGCCCAGGGCTGG - Intergenic
1125333520 15:38605109-38605131 ACAGGATTCTTGCTGAGGGCAGG - Intergenic
1127700574 15:61496313-61496335 CCTGGGGTCTTGCAAAGTGCTGG - Intergenic
1128765938 15:70251136-70251158 CCAGGAGTCCTGCATAGGCCGGG + Intergenic
1130679756 15:85986193-85986215 CCTGGTCTCTTCCTTATGGCTGG - Intergenic
1131365526 15:91835972-91835994 CATTGATTCTTGGTTAGGGCAGG + Intergenic
1132764404 16:1526935-1526957 CCTGCAGTCTTGCCCAGGGGCGG - Intronic
1135235808 16:20754798-20754820 TCTGGAGTTTTGCATAGAGCTGG + Intronic
1135762338 16:25147365-25147387 CCAGGAGGCCTGCTTAGGGTAGG + Intronic
1141133617 16:81451614-81451636 CCTGGAGTCATGCTTTGTTCTGG + Intronic
1143695367 17:8611293-8611315 TCTAGAGTTTTGCTTTGGGCAGG - Intronic
1144674070 17:17150785-17150807 CCTGGAGTCTGGCTGACTGCAGG - Intronic
1145815353 17:27791469-27791491 ACAGGATTCTTGCTTAGGACAGG - Intronic
1146426781 17:32747741-32747763 ACAGGAGACTTGCTTAGGCCTGG + Intronic
1147213209 17:38884197-38884219 CCTGGAGTGTGGCTGATGGCAGG + Intronic
1147557513 17:41488843-41488865 CCTGGGGTGTGGCTCAGGGCTGG - Intronic
1147769408 17:42857164-42857186 CCTTGAGACTTCCATAGGGCTGG - Exonic
1148123475 17:45225264-45225286 CCTGGAGTCCTGCTTGCAGCTGG + Intronic
1149535767 17:57432260-57432282 CCAGGAGACTTGCTCAGGGTCGG + Intronic
1149625731 17:58079361-58079383 CCTGGCAACTTGTTTAGGGCAGG + Intergenic
1150295420 17:64004874-64004896 TTTTGAGTCTTGCTTAGGGGAGG - Intronic
1151735981 17:75940777-75940799 CTAGGGGTCTTGCTTAGGGGTGG - Intronic
1152587685 17:81196318-81196340 CCTGGGGTCTGGCCTGGGGCCGG - Intronic
1152696776 17:81801568-81801590 ACAGGAATCTTGCTTAAGGCAGG + Intergenic
1157104037 18:44756515-44756537 CCTGGAGCCTGGCTTGTGGCTGG - Intronic
1157292367 18:46419304-46419326 CCTGAGGTCTGGCCTAGGGCTGG - Intronic
1160066671 18:75581840-75581862 CATGGCTTCTTGCTTAGGACTGG + Intergenic
1160232464 18:77058462-77058484 CCTGGGGTCGTGCCTGGGGCTGG - Intronic
1160550760 18:79692651-79692673 GCTGGTGTCTTGCATGGGGCAGG + Intronic
1162025784 19:7893409-7893431 CTTGGCTTTTTGCTTAGGGCAGG + Intronic
1162063433 19:8110717-8110739 CCTGCAGTCTTGCTGGGGGGTGG - Intronic
1163846569 19:19641651-19641673 CCTGGGGTCTCCCTGAGGGCTGG + Intronic
1164042855 19:21509036-21509058 AATGGAGTCTTGCTCAAGGCTGG + Intronic
1164151137 19:22552479-22552501 CCTGCACTGTTGCTTAGGCCTGG + Intergenic
1164419019 19:28071354-28071376 CCAGGATTCTTGCTGAAGGCAGG - Intergenic
1165808461 19:38596281-38596303 GGCGGAGTCTTGCTGAGGGCGGG - Intronic
1166932661 19:46310525-46310547 CCTGGTGTCATGCTTAGGAATGG + Intronic
925834340 2:7929436-7929458 CGTGGAGTCTGGGTTAGGGCTGG - Intergenic
926814977 2:16791299-16791321 ACAGGATTCTTGCTGAGGGCAGG - Intergenic
927004045 2:18828936-18828958 CTTGGATTCTTGCTTAGGCAAGG + Intergenic
930236637 2:48895047-48895069 CCTGGTCTGTTGCTTAGGTCTGG + Intergenic
930946625 2:57084163-57084185 CCTGGAGTCTTGCTGAGTCTGGG + Intergenic
932281005 2:70491781-70491803 CATGGAATCTTGCACAGGGCAGG - Intronic
933649708 2:84840710-84840732 CCTGCACTCTTGCTGAGGGTAGG - Intronic
933723000 2:85410110-85410132 CCTGGAGCCTGGCATAAGGCTGG + Intronic
933826054 2:86161916-86161938 CCTGGTGGCTTTCTTTGGGCCGG - Intronic
934515258 2:94982243-94982265 CCTGGACTCGGGCTTAGGGGAGG - Intergenic
934819201 2:97357340-97357362 ACTGGATTCTTCCTTAGGGGAGG + Intergenic
935683011 2:105654023-105654045 CCTGGAGTCTTGTTTTTGGTAGG - Intergenic
936074037 2:109390453-109390475 CCTGGAATCTTCCTTCTGGCAGG + Intronic
939325444 2:140682488-140682510 CCTGGACACTTGCCTTGGGCTGG + Intronic
939572454 2:143856647-143856669 TCTGAAGGCTTGATTAGGGCTGG + Intergenic
940601949 2:155874048-155874070 CCAGGTGGCTTGCTTGGGGCTGG - Intergenic
941506783 2:166356094-166356116 CCTGGAGTCTTGTCTGAGGCTGG + Intronic
942727920 2:179029934-179029956 CCAGGTGTCTTGCTTAGTCCTGG + Intronic
943496915 2:188631589-188631611 CCTTGAGTTTTCCTTGGGGCAGG - Intergenic
944418781 2:199506193-199506215 ACTGGAGTGTTGCTGAGAGCTGG + Intergenic
945351357 2:208784625-208784647 CATGGAGTCTTGCTGATTGCTGG + Intronic
945352684 2:208801010-208801032 CATGGAGTCTTGCTGATTGCTGG + Intronic
945822696 2:214684140-214684162 CATGGAGTCTTGCTGATTGCTGG + Intergenic
948152416 2:235754873-235754895 CCTTGTGTCTTGCTCAGGGGTGG + Intronic
948256505 2:236572564-236572586 CATTGTGTCTGGCTTAGGGCGGG + Intronic
1169112547 20:3043396-3043418 CCAGGACTCTTGCTTTAGGCTGG - Intergenic
1170314824 20:15031122-15031144 GCTGGAGCCTTGCATAGAGCTGG - Intronic
1173718358 20:45231005-45231027 CCTGGAGTCTTGAGGAGTGCAGG + Intergenic
1175178069 20:57125651-57125673 CCTGGTCTCTTGCTCAAGGCAGG + Intergenic
1176039570 20:63058063-63058085 CCTTGAGTCCTGCTTAGACCAGG - Intergenic
1178598060 21:33972753-33972775 CCTGGAGTCATCCTTCGGCCAGG - Intergenic
1180143806 21:45908878-45908900 CCTGGTGTCTGGCCTAGGGAAGG - Intronic
1180759846 22:18192689-18192711 ACAGCAGTATTGCTTAGGGCTGG + Intergenic
1180770158 22:18376991-18377013 ACAGCAGTATTGCTTAGGGCTGG + Intergenic
1180775822 22:18432011-18432033 ACAGCAGTATTGCTTAGGGCTGG - Intergenic
1180776172 22:18485675-18485697 ACAGCAGTATTGCTTAGGGCTGG - Intergenic
1180808896 22:18743046-18743068 ACAGCAGTATTGCTTAGGGCTGG - Intergenic
1180828098 22:18879945-18879967 ACAGCAGTATTGCTTAGGGCTGG + Intergenic
1181071823 22:20348023-20348045 ACAGCAGTATTGCTTAGGGCTGG - Intergenic
1181194893 22:21176968-21176990 ACAGCAGTATTGCTTAGGGCTGG - Intergenic
1181214552 22:21315806-21315828 ACAGCAGTATTGCTTAGGGCTGG + Intergenic
1181781967 22:25200118-25200140 CCTGGACATGTGCTTAGGGCAGG + Intronic
1181952519 22:26564657-26564679 CCTGAAGCCTTGCCTTGGGCCGG + Intronic
1183006229 22:34905063-34905085 ATTGGAGTCTTGCTTTGAGCTGG - Intergenic
1203231990 22_KI270731v1_random:118175-118197 ACAGCAGTATTGCTTAGGGCTGG + Intergenic
1203278197 22_KI270734v1_random:105945-105967 ACAGCAGTATTGCTTAGGGCTGG + Intergenic
950027757 3:9832513-9832535 CCTGGAGCCCAGCTGAGGGCAGG + Intronic
950310578 3:11954328-11954350 CATGGAGTCTGGCACAGGGCAGG + Intergenic
950521054 3:13498338-13498360 CCTGGACTGTTGCTTGGGGTAGG + Intronic
950612784 3:14136994-14137016 CCAGCAGTCCTGGTTAGGGCAGG - Intronic
951548539 3:23853715-23853737 CCTGTAGTCTTGCTTTGTACAGG + Intronic
954217698 3:49133566-49133588 CCTGGAGCTGTGCTTCGGGCTGG - Intergenic
956721296 3:72120318-72120340 CATAGAGTCTTGCTGTGGGCCGG + Intergenic
958772225 3:98438410-98438432 CCAGGATTCCTGCTGAGGGCAGG + Intergenic
961821046 3:129575825-129575847 CCTGGAGTGTAGTTTTGGGCTGG - Exonic
962414369 3:135168699-135168721 CCCTGACTCTTGCTCAGGGCTGG + Intronic
967865790 3:194188750-194188772 ACAGGAGTCTTGCTGAAGGCCGG - Intergenic
968625998 4:1626953-1626975 CCTGGAGGCTGCCTGAGGGCAGG + Intronic
969713992 4:8859820-8859842 CCTGGAAGCTTTCTTCGGGCCGG - Intronic
971066212 4:23035860-23035882 CCTGGAGTTCTGCCTGGGGCCGG + Intergenic
974204408 4:58681950-58681972 CCTTGATTTTTTCTTAGGGCAGG + Intergenic
977460173 4:97315105-97315127 CTTAGAGTCTTGCCTTGGGCTGG + Intronic
978333488 4:107641277-107641299 ACTGGATTCTTGCTGAAGGCAGG - Intronic
980306276 4:131065023-131065045 CCTGGAGTCTGGCTGAGTCCAGG + Intergenic
983034192 4:162842368-162842390 ACTGGATTCTTGCTGAAGGCAGG - Intergenic
984702536 4:182827416-182827438 CCTGGAGCCTGGCTGAGGGAGGG + Intergenic
985025602 4:185736664-185736686 CCTGGGGTCTTGCTTGGCTCAGG + Intronic
985936208 5:3100411-3100433 CCTGGAGGCTTGAGTGGGGCAGG - Intergenic
986142265 5:5041672-5041694 CCTGGAGCCTTGCTGAGCACCGG - Intergenic
987126772 5:14820558-14820580 ACAGGATTCTTGCTGAGGGCAGG + Intronic
987555085 5:19436058-19436080 CCTGGACTCTTGCTGGAGGCTGG + Intergenic
989730349 5:44641223-44641245 CCTGCAGCCTTGCATAGAGCTGG - Intergenic
991136747 5:63191310-63191332 TCTGGAGTCTGGCTTGGGTCGGG + Intergenic
993565193 5:89465987-89466009 CCTGTAGTCTTGGTGAGGGCAGG - Intergenic
994177355 5:96725349-96725371 TCTGGACACTTGCTTAGGACAGG - Intronic
997225877 5:132209076-132209098 CCTGGACTCTGGCTCTGGGCAGG - Intronic
997603110 5:135153948-135153970 CCAGGAGACTTGTTTAGGGTAGG + Intronic
997690183 5:135823029-135823051 CAAGGAGTCTGGCTTAGGACAGG + Intergenic
998019539 5:138757813-138757835 CCTGGAGTCTAGCTTGTGGATGG + Intronic
998110904 5:139501809-139501831 TCTGGAGGCTTGACTAGGGCTGG - Intergenic
998579052 5:143350863-143350885 CCTGGTGTCTAGCACAGGGCTGG + Intronic
998695052 5:144629586-144629608 CATGGAGCCTTGCTCAGTGCTGG - Intergenic
999408479 5:151328079-151328101 GCTGGAATCTTGCTTTGGCCAGG - Intronic
999440868 5:151599645-151599667 CCTGGAGTCTGACATAGGGCAGG + Intergenic
999956501 5:156709016-156709038 CCTAGAGTCTTGCTGAGAGCAGG + Intronic
1001122597 5:168992633-168992655 CCTGGGGTCCTGCTCAGGCCTGG + Intronic
1001330027 5:170755240-170755262 CCTGGATCCTTGCCTAGGTCTGG + Intergenic
1001803940 5:174567349-174567371 TCTGGGGTCTTGGTTAGGGGTGG + Intergenic
1002068213 5:176663041-176663063 CCTGGAATCATGCTTAGGGTGGG + Intergenic
1004273306 6:14213406-14213428 CCTGGAGGCTGGCTTAGGTCTGG - Intergenic
1008057767 6:46962905-46962927 CCTGGAGACTAGCTTCGGCCTGG - Intergenic
1009984973 6:70771513-70771535 CCCGGAGTCTTGCTGATTGCTGG - Intronic
1010934038 6:81839055-81839077 GCAGGGGTATTGCTTAGGGCAGG + Intergenic
1016758839 6:147715881-147715903 CCTGGAGTCTGGCTGAGTTCAGG + Intronic
1017718221 6:157226895-157226917 CCTGGAGCTATGCTAAGGGCTGG - Intergenic
1019285896 7:222717-222739 CCTGGAGTGCTGCTTGGTGCTGG + Intronic
1019494746 7:1332461-1332483 CCTGGTCTCTGGCTTGGGGCTGG + Intergenic
1019656382 7:2198295-2198317 CCTGGAGGCTTCCATGGGGCTGG - Intronic
1020474317 7:8577938-8577960 TCTGAAGGCTTGCATAGGGCTGG - Intronic
1023446180 7:40234309-40234331 CCTGGAGACTTGTTTTGTGCTGG + Intronic
1023684904 7:42723889-42723911 GCTGGAGACTTGCTTAATGCAGG + Intergenic
1024225177 7:47321067-47321089 CCTGGAGTCCTGCCTCAGGCTGG - Intronic
1028263439 7:88692837-88692859 CCTGTAGTCTTGCTTGGTTCTGG - Intergenic
1032299646 7:130675016-130675038 CCTAGGGTTTTGCTTATGGCTGG - Intronic
1034572537 7:151968479-151968501 GCTGGAGTAGTGCTTAGGGTAGG - Intronic
1034964858 7:155384626-155384648 CCTGGATTCTGGTTCAGGGCGGG - Intronic
1036151460 8:6302959-6302981 CCAAGAGTCTTCCTTTGGGCTGG - Intergenic
1037945271 8:22985807-22985829 CCTGGAGTCACTCTTCGGGCTGG + Intronic
1038937532 8:32268825-32268847 CCTGGAGACTTGCACAGGGCTGG - Intronic
1039455629 8:37704022-37704044 CCTGGAGTCCAGGGTAGGGCAGG + Intergenic
1043417493 8:80066092-80066114 CCTGGCGCCTTGCATTGGGCAGG - Intronic
1045848638 8:106666689-106666711 CCAGGATTCTTGCTGAAGGCAGG + Intronic
1047009916 8:120661149-120661171 CCTGGAGACTTGCTCAAGGCAGG + Intronic
1047404163 8:124571182-124571204 CCTGGAATCTGCCTCAGGGCAGG + Intronic
1047941271 8:129829740-129829762 ACAGGATTCTTGCTGAGGGCAGG - Intergenic
1048101385 8:131356103-131356125 CATGCAGTCTTGGTTAGTGCAGG + Intergenic
1049589408 8:143449706-143449728 CATGGAGTCTTGCTCCAGGCTGG - Intronic
1050295129 9:4196937-4196959 CCTGGAGTTCTGCCTAGGGGTGG - Intronic
1051822989 9:21190870-21190892 CCTGGAGTCTTGCTTAGGGCAGG - Intergenic
1051824813 9:21209405-21209427 CCTGGAGTCTTGCTTAGGGCAGG - Intronic
1051826809 9:21231482-21231504 CCTGGAGTCTTGCTTAGGGCAGG - Intronic
1051843120 9:21420588-21420610 CCTGGAGACCTGCTTGGTGCGGG + Intronic
1051846393 9:21455835-21455857 CCTGGAGACCTGCTTGGTGCAGG + Intergenic
1055142540 9:72892252-72892274 CCTGGAGTGCTGCTGAGGGCTGG + Intergenic
1056649465 9:88445570-88445592 GATGGAGTCTTGCTCTGGGCTGG + Intronic
1057298081 9:93860952-93860974 CCTGGAGCCTAGCGGAGGGCGGG + Intergenic
1060898819 9:127239173-127239195 CTTGTAGTCTTTCTTTGGGCAGG + Intronic
1061424784 9:130492184-130492206 CTTGGAGTCTTGCCTCTGGCTGG + Intronic
1061774217 9:132949788-132949810 CCAGGAGGCCTGCTTAGGTCTGG + Intronic
1186150634 X:6671315-6671337 CCTGAAGTCTTGCGTGGGGCGGG - Intergenic
1187122009 X:16418639-16418661 CCTGGAGTCTTGTTTTGAGCAGG - Intergenic
1187136630 X:16553894-16553916 ACTAGAGTCTTGCTTAGGAAGGG - Intergenic
1188890483 X:35606153-35606175 GTTAGAGTCTTGCTTCGGGCAGG - Intergenic
1196385110 X:115140598-115140620 CCTGAATTCTGGCTTGGGGCAGG - Intronic
1196802317 X:119554804-119554826 CCTGAAATCTTGATTAGGGCTGG - Intronic
1197031663 X:121823785-121823807 CCTGGAGACCTGCTTAGGCATGG - Intergenic
1199467507 X:148155807-148155829 TCTGGAGGCTTGCCTAGGGAAGG + Intergenic
1201624862 Y:16003843-16003865 GTTAGAGTCTTGCTTTGGGCAGG - Intergenic