ID: 1051826640

View in Genome Browser
Species Human (GRCh38)
Location 9:21228995-21229017
Sequence TGTTTGATCCTCAGTTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 5, 1: 0, 2: 0, 3: 34, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051826640_1051826643 24 Left 1051826640 9:21228995-21229017 CCTGAAGAACTGAGGATCAAACA 0: 5
1: 0
2: 0
3: 34
4: 222
Right 1051826643 9:21229042-21229064 ATGGCAGCCCAAATATATGCAGG No data
1051826640_1051826641 5 Left 1051826640 9:21228995-21229017 CCTGAAGAACTGAGGATCAAACA 0: 5
1: 0
2: 0
3: 34
4: 222
Right 1051826641 9:21229023-21229045 AATAACCATAAGATAGTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051826640 Original CRISPR TGTTTGATCCTCAGTTCTTC AGG (reversed) Intronic
905303603 1:37002559-37002581 TGTTTCATCATCATGTCTTCAGG + Intronic
907734561 1:57099549-57099571 TATTTAATCCTTAGTACTTCTGG + Intronic
907812485 1:57885018-57885040 TGTTTGACTCACAGTTCTGCAGG - Intronic
909503715 1:76363677-76363699 TAATTGATCCACAGTTCTACAGG + Intronic
910339860 1:86173664-86173686 TGTTTGATTCTGAGTTTTTGTGG + Intergenic
910386963 1:86694312-86694334 TGGGTGATCCTCACTTCTTGAGG + Intergenic
910702733 1:90093470-90093492 TGTTTGTTCTCCAGTTCTTGTGG + Intergenic
913325046 1:117620791-117620813 TGTTTCACCCTCAGATCATCAGG - Intronic
913719066 1:121573252-121573274 TGGTTAATCCTAGGTTCTTCAGG - Intergenic
913935651 1:125041451-125041473 TGTTTGATTTTTTGTTCTTCTGG + Intergenic
916491210 1:165304045-165304067 GGTTTAATCCTCAGTTCTACTGG + Intronic
917335686 1:173922298-173922320 TGTTTCATCCTTTGCTCTTCGGG + Intergenic
918195061 1:182213483-182213505 TTTTTGGTCCTCCTTTCTTCAGG + Intergenic
918837348 1:189484404-189484426 TGTTTGATTTTCTGTTCCTCTGG - Intergenic
918868103 1:189929960-189929982 TGTTTGCAGCTCAGTTTTTCAGG + Intergenic
919057746 1:192591862-192591884 TGTTTGATAATCAGTTATTCTGG + Intergenic
919232556 1:194792916-194792938 TCTTTAAACCTCAGTTTTTCTGG - Intergenic
919416157 1:197313017-197313039 TGATTGACTCACAGTTCTTCAGG + Intronic
919600183 1:199612756-199612778 TGTTTAATAGTCAGTTCTTTGGG - Intergenic
920674140 1:208027330-208027352 TTTTTGCTCCTCAGCTCATCGGG - Exonic
921286456 1:213614031-213614053 TGTTTGATCCTCATTATTTCTGG + Intergenic
921432257 1:215079310-215079332 GGATTGATTCACAGTTCTTCAGG + Intronic
921674507 1:217963184-217963206 TGTTTGAAGATCAGGTCTTCGGG - Intergenic
921955284 1:220976970-220976992 TGTTTGTTCCTCATACCTTCAGG + Intergenic
923199467 1:231697333-231697355 TGGTTGATCCTCAGTGTTTGTGG + Intronic
1064606308 10:17044048-17044070 TTTTTCTTCCTCACTTCTTCTGG - Intronic
1067933440 10:50586839-50586861 TGTTTAATTCTCATTTCCTCTGG + Intronic
1071988781 10:91078626-91078648 TGTTTGCTTCTCAGTTCTCAGGG - Intergenic
1072164765 10:92802521-92802543 TGTTTGAGCCGCTGTTATTCTGG + Intergenic
1072402265 10:95116786-95116808 TGTTTAACCCTCAGGTTTTCAGG + Intergenic
1073113944 10:101080380-101080402 TGTTTGAGCCACAGTTGTGCTGG + Intergenic
1074477033 10:113782750-113782772 TGATTGGTCCACAGTTCTGCAGG - Intronic
1077028222 11:451055-451077 TGGTTGCTCCTCAGTGCTTGCGG + Intronic
1080056797 11:27915170-27915192 TATTTGATTCCCAGTTCTGCAGG + Intergenic
1080992128 11:37549616-37549638 GGTTTGCTCCTCAGTTCTTTGGG + Intergenic
1082052179 11:47780259-47780281 AGCTTGATCTTCAGTTCTCCGGG - Intronic
1082935424 11:58652070-58652092 GGTTTGTTCCACAGGTCTTCTGG - Intronic
1083726518 11:64631230-64631252 AGTTTGACCCTCAGCTCTTCTGG - Intronic
1084752494 11:71213486-71213508 TGTTTGAACCTCTGTTTTACAGG - Intronic
1084976974 11:72806505-72806527 TATTTGATTCACAGTTCTGCAGG + Intergenic
1087069969 11:94068623-94068645 TGTGTGATCCTTAGCTCTTTTGG + Intronic
1088517027 11:110648390-110648412 TGTTTAATCCTCAGTTATCAAGG - Intronic
1092701254 12:11233578-11233600 TATTTGATTCACAGTTCTGCAGG + Intergenic
1093712266 12:22340406-22340428 TGTTTCATCATCAGGTTTTCAGG + Intronic
1093724820 12:22492159-22492181 TGTTAGATCCTCTGCTCTTGTGG - Intronic
1094040952 12:26122033-26122055 TGCTTGAACCTCCGTCCTTCGGG + Exonic
1094745422 12:33338977-33338999 TGTTTTTTCTTTAGTTCTTCAGG - Intergenic
1095052138 12:37563832-37563854 TGATTGATCCTCAGTACTTTTGG + Intergenic
1098233918 12:68400299-68400321 TGTATGATCTTCAGTTTTTATGG + Intergenic
1101334693 12:103786091-103786113 TGTTTTATCCTCAGTATTTAGGG - Intronic
1101602775 12:106224848-106224870 TGTTTGATTGTGAGGTCTTCAGG - Intergenic
1101738998 12:107485235-107485257 TGTTGATTCCTCAGTTTTTCAGG + Intronic
1102700487 12:114834921-114834943 TGGTTCTTCCTCAGTCCTTCTGG + Intergenic
1104357220 12:128098099-128098121 TGATTGATCATAAATTCTTCTGG + Intergenic
1104368066 12:128195876-128195898 TCTTTAATCCTCAGTTCTCCAGG - Intergenic
1107317267 13:39146545-39146567 TTTTTGATACTCATGTCTTCTGG - Intergenic
1107869980 13:44737380-44737402 AGTTTGATCTTTTGTTCTTCGGG - Intergenic
1108586009 13:51870444-51870466 TCTTTCATTCTCATTTCTTCTGG - Intergenic
1108980314 13:56502834-56502856 TATTTGGTCCACAGTTCTGCAGG + Intergenic
1110730370 13:78873651-78873673 TGTTTAAGTCTTAGTTCTTCAGG - Intergenic
1112307016 13:98283993-98284015 TGTTTGCTCCTCAGTTGCACTGG + Intronic
1112504038 13:99964402-99964424 TTTTCGATCCTAAGTTCTTTGGG - Exonic
1114797471 14:25732633-25732655 TGTTTGATCCACTGTTCATTTGG + Intergenic
1117784507 14:59268562-59268584 TATTTTGTCCTCAGTTCTTCAGG - Intronic
1118162114 14:63301173-63301195 TATTTGACCCTAAGTTCCTCTGG - Intergenic
1119902625 14:78274263-78274285 TGATTGACTCTCAGTTCTGCAGG + Intronic
1120664587 14:87291050-87291072 TGATTGATTCACAGTTCTACAGG - Intergenic
1121149798 14:91621929-91621951 TGTTTAATCTCCAGTTGTTCAGG - Exonic
1121814513 14:96918860-96918882 TGTTTGATCCTCTGCTGTGCGGG + Intronic
1202839293 14_GL000009v2_random:106491-106513 TGTTTGCTCCTCTCTGCTTCTGG - Intergenic
1202908669 14_GL000194v1_random:96644-96666 TGTTTGCTCCTCTCTGCTTCTGG - Intergenic
1123816738 15:23987597-23987619 TGTTTGATGCTCAGACTTTCTGG - Intergenic
1124690060 15:31814366-31814388 GGTGGGATTCTCAGTTCTTCAGG - Intronic
1126929714 15:53634235-53634257 TGTTTGTTCCTCAGGTCCTGAGG - Intronic
1129117663 15:73374320-73374342 TGTATTATACTCAGTCCTTCTGG + Intergenic
1129901607 15:79155682-79155704 TGGTTGTGCCTCAATTCTTCAGG + Intergenic
1130784244 15:87078190-87078212 TGTTTGGTATTCTGTTCTTCAGG + Intergenic
1130808085 15:87348072-87348094 AGTCTGTTCCTCAGTTCTTCAGG - Intergenic
1130883014 15:88071162-88071184 TGTGCAATCCTCAGTTCATCGGG - Intronic
1131805590 15:96118905-96118927 TCTTTAATCATCATTTCTTCAGG + Intergenic
1137553060 16:49453563-49453585 TGTTGGATCCTCAGCTATGCTGG + Intergenic
1137984856 16:53099162-53099184 TGTCTGAGCCTCACTTCCTCTGG - Intronic
1138963224 16:62051925-62051947 TGTTTGCAGCTCAGTTTTTCAGG + Intergenic
1140398951 16:74654362-74654384 TGTTTGTTCCTCTGTTATTTAGG + Intronic
1140948665 16:79795243-79795265 TGGTGGATCCTGAGGTCTTCAGG - Intergenic
1145372634 17:22319747-22319769 TGATTGATCCTCAGTGCTTTGGG + Intergenic
1146499688 17:33353748-33353770 TTTATGATCCTCAGTTCTTTGGG + Intronic
1146635030 17:34497458-34497480 TCTCTGGACCTCAGTTCTTCTGG + Intergenic
1146953276 17:36921165-36921187 TGTTTGTTTCTCTGATCTTCTGG + Intergenic
1148702211 17:49595402-49595424 TTTTTAGTCCTCAGTTCTACGGG + Intergenic
1148743884 17:49907863-49907885 TGTTTGCTCCTCTCTCCTTCTGG + Intergenic
1150862440 17:68815167-68815189 TGTATGATCCTCATTTCATTCGG + Intergenic
1152810474 17:82379572-82379594 AGATTGATCCGCAGTTCCTCCGG + Intergenic
1154062431 18:11074497-11074519 TTTTTGATTGTGAGTTCTTCAGG - Intronic
1156119378 18:33823272-33823294 TATTTGATCCTCTGTTCTTTTGG + Intergenic
1160089900 18:75816840-75816862 TGTTGAATCCCCAGTCCTTCAGG - Intergenic
1160126462 18:76177128-76177150 TGATTGATCATCGGTGCTTCTGG - Intergenic
1160301410 18:77684109-77684131 TGTTTGACTCACAGTTCCTCAGG + Intergenic
1165571812 19:36781756-36781778 TGATTGATCCTCAGTGCTTTGGG - Intergenic
1167410346 19:49340402-49340424 TGTTTAATCCCCAGTTCGCCTGG + Exonic
1168375995 19:55879687-55879709 TGTTTGCAGCTCAGTTTTTCAGG + Intronic
1202633742 1_KI270706v1_random:24044-24066 TGTTTGCTCCTCTCTGCTTCTGG + Intergenic
1202652141 1_KI270707v1_random:16012-16034 TGTTTGCTCCTCTCTGCTTCTGG - Intergenic
925044198 2:758791-758813 TGCCTAAGCCTCAGTTCTTCGGG + Intergenic
925669817 2:6299323-6299345 TGTTGAATGCTCATTTCTTCTGG - Intergenic
926160969 2:10489050-10489072 TGTTTGAGCCTCTGTAGTTCAGG + Intergenic
929753976 2:44748366-44748388 TGTTTGAAGCTCAGTTCTTAAGG + Intronic
930502558 2:52240307-52240329 GGCTTGATCATCAGTTCTTCAGG - Intergenic
930805245 2:55483813-55483835 TGTTTGACCCCCAGTGGTTCTGG + Intergenic
933285802 2:80383398-80383420 AGTTTCATCCTGAGTTCTTTGGG + Intronic
935056851 2:99575070-99575092 TAATTAATTCTCAGTTCTTCAGG - Intronic
937709327 2:124961170-124961192 TGTATGAGACCCAGTTCTTCTGG + Intergenic
942244444 2:173994094-173994116 TATTGGATCCCCAGTTCCTCAGG - Intergenic
942987146 2:182156612-182156634 TATTTGAAATTCAGTTCTTCAGG + Intronic
943430175 2:187789841-187789863 TCTTTAAACCTCAGTTCTCCTGG - Intergenic
946775514 2:223136163-223136185 TGCTTGATCATCTGTTGTTCAGG + Intronic
1169609294 20:7361320-7361342 TGCTTGATGCTCAGATCTGCAGG - Intergenic
1169684001 20:8249954-8249976 GGCTTGAGCCTCAGTTCCTCAGG - Intronic
1170174073 20:13448114-13448136 TTTTAGAACTTCAGTTCTTCTGG + Intronic
1171546671 20:26007345-26007367 TGATTGATCCTCAGTGCTTTGGG + Intergenic
1172475313 20:35232894-35232916 AGTTTGTTCCTGAGTTGTTCTGG + Intronic
1174337280 20:49871929-49871951 TGTTAGATCCTCAGTCCCACAGG + Intronic
1174960281 20:55148599-55148621 TGCTTGCTCCTCATTTATTCTGG - Intergenic
1176413640 21:6462201-6462223 TGTTTGACACTCAGACCTTCTGG + Intergenic
1176600012 21:8783641-8783663 TGTTTGCTCCTCTCTGCTTCTGG + Intergenic
1176645958 21:9349900-9349922 TGTTTGCTCCTCTCTGCTTCTGG + Intergenic
1178862127 21:36298213-36298235 TCTCTGAGCCTCAGTTCTGCTGG - Intergenic
1179689138 21:43070524-43070546 TGTTTGACACTCAGACCTTCTGG + Intronic
1180366968 22:11949253-11949275 TGTTTGCTCCTCTCTGCTTCTGG - Intergenic
1180379118 22:12122105-12122127 TGTTTGCTCCTCTCTGCTTCTGG + Intergenic
1180418408 22:12791220-12791242 TGTTTGCTCCTCTCTGCTTCTGG - Intergenic
1184293618 22:43510664-43510686 TGTTGGAGCCTCAGCTCTTGGGG + Intergenic
950475321 3:13211200-13211222 GGCTGGATCCTCATTTCTTCAGG - Intergenic
950906406 3:16542915-16542937 TGTTTGAGCCACAGTACTTAGGG - Intergenic
951017473 3:17746009-17746031 TGATTAATCCTCAGTAGTTCAGG - Intronic
951674574 3:25222369-25222391 TGTTTGACTTTCATTTCTTCGGG + Intronic
952486504 3:33816912-33816934 TTTTTGCTTCCCAGTTCTTCTGG - Intronic
955645540 3:61133654-61133676 TCTTTGAGCCTCTTTTCTTCTGG - Intronic
956087752 3:65631078-65631100 TGTGTGATCATCAGCTCTACTGG - Intronic
956358384 3:68418725-68418747 TGTTTGTTCATCAGTTTTTCTGG - Intronic
957094237 3:75763544-75763566 TGTTTGCTCCTCTCTGCTTCTGG - Intronic
957118410 3:76057324-76057346 AGTATGATCCTCAGTACCTCAGG + Intronic
957568146 3:81910554-81910576 TTTTTCATCCTCCGTTCTTGTGG - Intergenic
957998145 3:87717065-87717087 TCATAGATCTTCAGTTCTTCGGG - Intergenic
958693452 3:97497994-97498016 TGTTTTAACCTCAGTCATTCTGG - Intronic
958869699 3:99543374-99543396 TGTTTGCTCCTCCCTTCCTCTGG + Intergenic
960631105 3:119731570-119731592 TGTTTGATTCTCAGCACTTCTGG - Intronic
961435720 3:126915229-126915251 TCTCTGAGCCTCAGTTCCTCTGG - Intronic
961788141 3:129359658-129359680 GGCTGGATCCTCATTTCTTCAGG + Intergenic
963317810 3:143779346-143779368 TCTTTAATCCTCAGTTTTTTGGG + Intronic
963414671 3:144979558-144979580 TTTTTAATCCTGAGCTCTTCTGG + Intergenic
963533788 3:146502902-146502924 TGTTTGGCTCACAGTTCTTCAGG - Intergenic
964307205 3:155354811-155354833 ACTTTGTTCCTCAGATCTTCTGG - Intergenic
964764814 3:160169564-160169586 TCTTTGAATCTCAGGTCTTCTGG + Intergenic
964994192 3:162854333-162854355 TCATAGATCTTCAGTTCTTCTGG - Intergenic
965331304 3:167378103-167378125 GGTTTGATTCACAGTTCTGCAGG - Intronic
966145946 3:176812201-176812223 TGGTTGATCCCCAGTGCTTAAGG - Intergenic
968300309 3:197608005-197608027 TGTTTGGTACTAAGTCCTTCTGG + Intergenic
1202740929 3_GL000221v1_random:55163-55185 TGTTTGCTCCTCTCTGCTTCTGG - Intergenic
971688546 4:29803085-29803107 TGTTTCATCATCATTTCTGCAGG + Intergenic
971730079 4:30367721-30367743 TGTTTGTTCCTCAGTATTGCAGG + Intergenic
971847765 4:31943006-31943028 TGTTTGATCTTCAATTTTTGTGG - Intergenic
973363376 4:49186059-49186081 TGTTTGCTCCTCTCTGCTTCTGG + Intergenic
973397720 4:49610798-49610820 TGTTTGCTCCTCTCTGCTTCTGG - Intergenic
976124785 4:81821798-81821820 TGCTTGAACATCATTTCTTCAGG + Intronic
978296808 4:107214935-107214957 TGTTTCAGCCTCAGATCTACGGG - Intronic
979669506 4:123347210-123347232 TTTTTGGTTCTCAGTTCTGCAGG - Intergenic
980035032 4:127873272-127873294 TAATTGACCCACAGTTCTTCAGG - Intergenic
981129746 4:141145089-141145111 TTTTTAATCCTCATTTTTTCTGG - Intronic
981727701 4:147864522-147864544 CCTTTGATCTTCAGTTCTTGGGG + Intronic
981849706 4:149215569-149215591 TGTTTGAGCCTCTGCTCTGCAGG + Intergenic
983839733 4:172442331-172442353 TATTTGTTTCTCACTTCTTCTGG + Intronic
1202760735 4_GL000008v2_random:107584-107606 TGTTTGCTCCTCTCTGCTTCTGG + Intergenic
985676241 5:1232673-1232695 TGTTTTATTCTCACTGCTTCTGG + Intronic
986253001 5:6078239-6078261 TGTTTGATTTTCAGTTCTCCTGG - Intergenic
989632764 5:43503513-43503535 TGTTTGATCCTGAGTTTTACAGG - Intronic
989959537 5:50394818-50394840 TGGTTAATCCTAGGTTCTTCAGG + Intergenic
992050916 5:72940051-72940073 TGTTTGATCTTCACTGCTTTTGG - Intergenic
992475139 5:77094662-77094684 TATTTGACTCTCAGTTCTGCAGG + Intergenic
993106487 5:83606351-83606373 TATTTTTGCCTCAGTTCTTCTGG + Intergenic
993701985 5:91129487-91129509 AGTTTGATCCTCAGTTTTACAGG + Intronic
993920958 5:93801338-93801360 TGTTTGATCCTTTGTTATTTTGG - Intronic
994449064 5:99917480-99917502 TAATTGACTCTCAGTTCTTCAGG - Intergenic
996430680 5:123373128-123373150 TGTTTGTTCCTCTCTGCTTCTGG - Intronic
996630178 5:125622074-125622096 TGCTTAATATTCAGTTCTTCAGG - Intergenic
997199608 5:132001910-132001932 TGTTTGCTCCTCTGTTCTCAAGG - Intronic
999104682 5:149060857-149060879 TTTTTGAACCTCAGTTTTCCTGG - Intronic
999510450 5:152245207-152245229 TGTTTGATTCTAAGTTCATCAGG + Intergenic
1000539051 5:162516608-162516630 TAATTGATTCACAGTTCTTCAGG + Intergenic
1000634635 5:163630100-163630122 TGTATGTTCCTCAGTTCTTTAGG + Intergenic
1001946182 5:175780032-175780054 TATTTGACTCACAGTTCTTCAGG - Intergenic
1002384077 5:178852662-178852684 TATTTGCTCCTCTTTTCTTCTGG - Intergenic
1002461256 5:179375057-179375079 TATTTGGTCCACAGTTCTGCAGG + Intergenic
1003987128 6:11448115-11448137 TATTTAGTTCTCAGTTCTTCAGG + Intergenic
1004965434 6:20844355-20844377 TGTTTGGCGCTCAGTTCTTGTGG + Intronic
1006055399 6:31380124-31380146 TGTGTCATCCTCAGCTCTTCAGG + Intergenic
1009988687 6:70813931-70813953 TGTTTAATCCTTAATTCATCTGG + Intronic
1011411474 6:87070986-87071008 TGTGAGATACTCAGTCCTTCTGG + Intergenic
1012021570 6:93927944-93927966 TATTTGATTCACAGTTCTGCAGG - Intergenic
1012155720 6:95817665-95817687 TTTTTCAACCTCAGTTTTTCTGG + Intergenic
1012223361 6:96677989-96678011 GGTTTGATTCACAGTTCTGCAGG + Intergenic
1016780050 6:147947480-147947502 TGTTTTATCTTCATTGCTTCAGG + Intergenic
1020399358 7:7757907-7757929 TGTTTGATCCTATCTTCTTATGG + Intronic
1022112575 7:27240471-27240493 TGTTTGATCCGCTTTTCTTCTGG - Intergenic
1024895586 7:54258097-54258119 TGTTTGATGCTGTGTTGTTCTGG - Intergenic
1025140567 7:56460062-56460084 TGTTTCATCCACAGTTCATAAGG - Intergenic
1027693715 7:81381828-81381850 TGTTTGGTCCTCATTTCTAATGG - Intergenic
1027983664 7:85257975-85257997 GGTTTGGCCCTCAATTCTTCGGG - Intergenic
1033634801 7:143202157-143202179 TCTTTGATCTTTATTTCTTCAGG + Intergenic
1037698058 8:21245071-21245093 TCATAGATCTTCAGTTCTTCTGG + Intergenic
1038535242 8:28348960-28348982 TGTTTGGTCCTCAGAGCCTCTGG - Intronic
1038882926 8:31634658-31634680 TGCTGGATGCTCAGTACTTCCGG - Intergenic
1040775685 8:51040502-51040524 TGTTTGAGCCTCAACTCTTCAGG + Intergenic
1041102188 8:54407648-54407670 TGTATGTTTCTCATTTCTTCTGG + Intergenic
1042003672 8:64156087-64156109 TGTTTCATCTTCAGCACTTCTGG + Intergenic
1042193265 8:66209590-66209612 TGTTTGCTCCTCTGTTCTCAGGG - Intergenic
1044459860 8:92430835-92430857 TATTTGGTTCACAGTTCTTCAGG - Intergenic
1044603157 8:94025886-94025908 TGTCTTAGCCTGAGTTCTTCGGG - Intergenic
1047987639 8:130251716-130251738 TTTTTGTCCCTCTGTTCTTCTGG - Intronic
1049990492 9:986423-986445 TGTTTGATCCACTTTTTTTCTGG + Intronic
1050056878 9:1664943-1664965 TCTTTGATTCTCAGTTTTTTTGG - Intergenic
1050243923 9:3668025-3668047 TGTTTGGTCCTTAGATTTTCAGG - Intergenic
1051244359 9:15094313-15094335 TCCTAGATCCTCATTTCTTCTGG + Intergenic
1051820960 9:21167441-21167463 TGTTTGATCCTCAGTTCTTCAGG - Intergenic
1051824371 9:21202989-21203011 TGTTTGATCCTCAGTTCTTCAGG - Intergenic
1051824712 9:21207919-21207941 TGTTTGATCCTCAGTTCTTCAGG - Intronic
1051825809 9:21218130-21218152 TGTTTGATCCTCAGTTCTTCAGG - Intronic
1051826640 9:21228995-21229017 TGTTTGATCCTCAGTTCTTCAGG - Intronic
1052738162 9:32366374-32366396 AGTTGGCTCCTGAGTTCTTCTGG - Intergenic
1053798139 9:41744806-41744828 TGATTGATCCTCAGTGCTTTGGG - Intergenic
1054147062 9:61570136-61570158 TGATTGATCCTCAGTGCTTTGGG + Intergenic
1054186553 9:61956858-61956880 TGATTGATCCTCAGTGCTTTGGG - Intergenic
1054466797 9:65501196-65501218 TGATTGATCCTCAGTGCTTTGGG + Intergenic
1054651952 9:67631662-67631684 TGATTGATCCTCAGTGCTTTGGG + Intergenic
1054707744 9:68479954-68479976 TCTGTGTTCCTCAGATCTTCTGG - Intronic
1054786861 9:69218476-69218498 TCTTGGATCCTCAGTACTTTTGG + Intronic
1055897597 9:81196936-81196958 TCTTAGAACCTCTGTTCTTCAGG - Intergenic
1057896162 9:98910421-98910443 TGCTTGTTCCTCAGTTTTTCTGG - Intergenic
1059214179 9:112545135-112545157 AGTTTCATCCTTAGTTTTTCTGG + Intronic
1060921509 9:127423784-127423806 TGTTTGATCAGCACTTCTGCGGG - Intergenic
1203483117 Un_GL000224v1:25357-25379 TGTTTGCTCCTCTTTGCTTCTGG + Intergenic
1203709567 Un_KI270742v1:85093-85115 TGTTTGCTCCTCTCTGCTTCTGG - Intergenic
1203541506 Un_KI270743v1:92470-92492 TGTTTGCTCCTCTCTGCTTCTGG + Intergenic
1187600763 X:20827099-20827121 TGTTTAAAACTCAGTTCTTGAGG - Intergenic
1188849228 X:35111421-35111443 TATTTGGCCCACAGTTCTTCAGG + Intergenic
1189028428 X:37424403-37424425 TGTGTGATAATCAGTCCTTCAGG + Intronic
1189560040 X:42183113-42183135 TATTTGACTCACAGTTCTTCAGG + Intergenic
1191081371 X:56513849-56513871 TGTTTGATTGTCTGTTCTTGTGG - Intergenic
1191764306 X:64680539-64680561 TTTTTGATCATCAGTTGTTCAGG - Intergenic
1191764312 X:64680645-64680667 TTTTTGATCATCAGTTGTTCAGG - Intergenic
1194189214 X:90813998-90814020 TGTATTATCCTGAGTTTTTCAGG - Intergenic
1194921708 X:99774795-99774817 TCTTTGTTCCTTAGTTATTCTGG + Intergenic
1195732807 X:107982577-107982599 TTTTTGGTCCTAAGTCCTTCCGG - Intergenic
1196546768 X:116972613-116972635 TAATTGGTTCTCAGTTCTTCAGG - Intergenic
1198436748 X:136624615-136624637 GGTTTGATCCTTAGTACTACTGG + Intergenic
1198790513 X:140340248-140340270 TGTTTGGTTCACAGTTCTGCAGG - Intergenic
1200311022 X:155077499-155077521 TGTTTGACCCTGAGATCTTTTGG - Intronic
1200535794 Y:4395891-4395913 TGTATTATCCTGAGTTTTTCAGG - Intergenic
1201164526 Y:11196612-11196634 TGTTTGCTCCTCTCTGCTTCTGG - Intergenic
1201864615 Y:18636458-18636480 TGGGTGATCCTCTGTTCTTGAGG - Intergenic
1201868707 Y:18683920-18683942 TGGGTGATCCTCTGTTCTTGAGG + Intergenic