ID: 1051826642

View in Genome Browser
Species Human (GRCh38)
Location 9:21229028-21229050
Sequence GGCTGCCATTGACTATCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 3, 1: 2, 2: 1, 3: 9, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051826642_1051826643 -9 Left 1051826642 9:21229028-21229050 CCATAAGATAGTCAATGGCAGCC 0: 3
1: 2
2: 1
3: 9
4: 83
Right 1051826643 9:21229042-21229064 ATGGCAGCCCAAATATATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051826642 Original CRISPR GGCTGCCATTGACTATCTTA TGG (reversed) Intronic
905607298 1:39313695-39313717 GGCTTCCATTGGCTAACTTTGGG - Intronic
908252612 1:62276874-62276896 GGCTTCCATTGTCTATATTTTGG - Intronic
911106077 1:94132828-94132850 GGCTCCCATTGCCTTCCTTATGG + Intergenic
913081809 1:115395241-115395263 GGCTGGCATTGAGTATCTGTGGG + Intergenic
915944343 1:160139025-160139047 TTCTGCCATTGACTAGCTTTGGG - Intronic
924499090 1:244619504-244619526 AGCTGCCTTTGAATAGCTTAGGG - Intronic
1064160949 10:12945834-12945856 GGTTGCCTTTGACTATCTGTTGG + Intronic
1064574645 10:16731972-16731994 GGCTTTCATTGACTTCCTTAAGG + Intronic
1068737515 10:60431140-60431162 GGCTCCCACTGACTACATTATGG - Intronic
1072345993 10:94506922-94506944 CTCTGCCATTTACTATCTGAGGG - Intronic
1076008411 10:126966943-126966965 GGCTGCCAATGAGCATCTTCAGG - Intronic
1078838609 11:15056350-15056372 TGCTGCCATTTACTATGATAGGG + Intronic
1079293300 11:19208428-19208450 GGCTGACATTGAATACATTATGG - Intronic
1080066510 11:28021855-28021877 GGGTGCCATTGACTTTTTTCAGG + Intronic
1082898934 11:58225030-58225052 GGCTACTATTGACTTTCTGATGG - Intergenic
1087129799 11:94658791-94658813 GGTTTCCTTTGAATATCTTATGG - Intergenic
1089972298 11:122703927-122703949 GGCTGTCCTTCCCTATCTTATGG + Intronic
1091006215 11:131956082-131956104 GTCTGCCATTGATTTTCTTTAGG + Intronic
1098988804 12:77042201-77042223 GTGTGCCAATGACTATATTAAGG - Intronic
1099284197 12:80695370-80695392 GGCTGATATTAACTCTCTTAGGG + Intergenic
1101831216 12:108258246-108258268 GTCTGCCATTGGCTAACTTGAGG + Intergenic
1102602702 12:114044382-114044404 GGCTTGCATTGACTCCCTTATGG - Intergenic
1104201930 12:126598107-126598129 GGCTGCCGTTTGCTTTCTTAAGG - Intergenic
1104518150 12:129446880-129446902 GGCTGGCATTAACTGTCTTTAGG + Intronic
1107177436 13:37415326-37415348 GGCTGTCATTAACTATCATAAGG - Intergenic
1107581214 13:41788808-41788830 GACTGGCATTGACTATTTTCAGG + Intronic
1108372287 13:49782153-49782175 TTCTGCCATTGGCTATCTTATGG - Intronic
1111367772 13:87272063-87272085 GGCTGGCATTAAGTAGCTTATGG - Intergenic
1114139821 14:19896828-19896850 GGCTGCCAGTGACTCTGTTAGGG + Intergenic
1114986062 14:28230485-28230507 GGCTGCCATTGAGTGTCTGTGGG + Intergenic
1118860382 14:69658451-69658473 GGCTGCTTTTAACTAACTTATGG + Intronic
1121255274 14:92526046-92526068 GCCTGTCATTGACAATCTTCTGG + Intronic
1131116118 15:89797063-89797085 GGCTGCTTTGGAGTATCTTAAGG - Intronic
1145900987 17:28490453-28490475 GGTTGCCGTCGAGTATCTTAAGG + Exonic
1148810276 17:50285918-50285940 GGTTGCCCTTGCCTATCTTCTGG + Intergenic
1151313771 17:73310093-73310115 GGCTGCCAGGGGCTCTCTTAGGG + Intronic
1166624719 19:44340380-44340402 GGCTGCCATTGAGTAACTAAGGG + Intronic
1168026045 19:53644334-53644356 GGCTGCCTTTGGCTCTCTGAAGG - Intergenic
929382465 2:41368810-41368832 GGATGCCATTGAGTGTCTTATGG + Intergenic
942906858 2:181193405-181193427 TCTTGACATTGACTATCTTAGGG - Intergenic
946639762 2:221771479-221771501 TGCTGACAATGACTATCTTTAGG + Intergenic
1170681095 20:18526352-18526374 TGCTGCCATTCGCTATTTTAGGG + Exonic
1171455795 20:25271462-25271484 GCCAGCCATTGACAATCTTCTGG - Exonic
1175013108 20:55760154-55760176 GCCTGCCTTTGACTTTCTTCTGG + Intergenic
1176999031 21:15589209-15589231 TGCTGCACTTGACCATCTTAGGG - Intergenic
1182487485 22:30648046-30648068 GGCTACCATTGCCCATCTTCTGG + Intronic
957471877 3:80668720-80668742 GGCTGGCATTGAGTGTCTTTGGG - Intergenic
957959638 3:87232678-87232700 GGCTACCATTTCCTATCTTCAGG + Intronic
958583142 3:96052268-96052290 GTCTGACATTGAGTATCTGAGGG + Intergenic
960015012 3:112877310-112877332 AGCTACCATTGACTTTCTCATGG - Intergenic
960089991 3:113629321-113629343 GGCTTCCATTGACCATATGAAGG + Exonic
960740238 3:120825189-120825211 GGTTGCCGTTCATTATCTTAGGG + Intergenic
963159558 3:142136918-142136940 AGCTACCAATGACTTTCTTACGG - Intronic
967867251 3:194200419-194200441 GGCTGACATGGACTTTCTGAAGG - Intergenic
970593722 4:17580648-17580670 GGCTGCTATTAACTATCCTAGGG - Intronic
971045285 4:22799081-22799103 GGCTTCCATTAACTTCCTTAGGG + Intergenic
974557829 4:63474457-63474479 GGCTGACCTTTACTATCTGAAGG + Intergenic
976385892 4:84457846-84457868 GTCTGCAACTGACTATCTAATGG - Intergenic
980103165 4:128562174-128562196 GGCTGGGATTGACTGGCTTAAGG - Intergenic
983067307 4:163226343-163226365 GGCTGTCAATGCCAATCTTAAGG + Intergenic
989419622 5:41221596-41221618 GGCTGCCATTGGCTACCTTATGG + Intronic
992555277 5:77897002-77897024 GATTGCCTTTGAATATCTTATGG + Intergenic
995320368 5:110826647-110826669 GGCTATCATTAATTATCTTAGGG - Intergenic
995723794 5:115165149-115165171 GGCTGGCATTGAGTATCTGCAGG + Intronic
999247243 5:150161711-150161733 GGATGCCACTGATTATCCTAGGG - Intergenic
1003390882 6:5711698-5711720 GGGTGGCATTGACTATTTTGAGG - Intronic
1005713370 6:28523707-28523729 GGCTGGCAGTGCCAATCTTATGG + Intronic
1009396212 6:63203542-63203564 GGCTGGCATTGAGTATCTGCAGG + Intergenic
1019478005 7:1253214-1253236 GGCTACCATTGACTTAATTAAGG - Intergenic
1021323437 7:19239569-19239591 GGCTGGCATTGAGTATCTGCAGG + Intergenic
1027453375 7:78358564-78358586 GGCTGCCCTGGACCACCTTATGG + Intronic
1034973566 7:155434969-155434991 GGTTGCCATTGACTTTCTTGTGG - Intergenic
1042045510 8:64646767-64646789 AACTGCCCTTGACTAGCTTAGGG + Intronic
1046674226 8:117090772-117090794 GGCTGCCATGGGACATCTTAAGG - Intronic
1048580732 8:135728267-135728289 GGATGCCAGTGACTATCATCTGG - Intergenic
1048885792 8:138908574-138908596 TTCTGCCATTTACTATCTAAGGG + Intronic
1051820961 9:21167474-21167496 GGCTGTCATTGACTATCTTATGG - Intergenic
1051822818 9:21188385-21188407 GGCTGCCATTGACTATCTTATGG - Intergenic
1051824373 9:21203022-21203044 TGCTGCCATTGACTATCTTATGG - Intergenic
1051825811 9:21218163-21218185 GGCTGCCATTGACTATCTTATGG - Intronic
1051826642 9:21229028-21229050 GGCTGCCATTGACTATCTTATGG - Intronic
1053054137 9:34983918-34983940 AGCAGCCATTGATTCTCTTAAGG - Intergenic
1053407728 9:37891923-37891945 GCCTGGCTGTGACTATCTTATGG - Intronic
1053563757 9:39224936-39224958 GGCTGACATAAAATATCTTAGGG + Intronic
1054133390 9:61394131-61394153 GGCTGACATAAAATATCTTAGGG - Intergenic
1058268148 9:102933522-102933544 AGGTGTCATTGACTATGTTAAGG - Intergenic
1059342592 9:113607149-113607171 GGCTGCCATTGGCTATCCTTAGG - Intergenic
1060984736 9:127813529-127813551 GGCTGCCAGTGACTAGCACATGG - Exonic
1190923196 X:54876837-54876859 GTCTGTCTTTGAGTATCTTATGG - Intergenic
1194141961 X:90219143-90219165 GGCTGCCATTTTCTATTGTAAGG - Intergenic
1197236897 X:124076531-124076553 GGCTGCCATTGAATTCTTTAAGG + Intronic
1197989722 X:132304924-132304946 GGCTGCCATTTACTCTATCATGG + Intergenic
1199733864 X:150665886-150665908 GGCTGCCAGTGACCATCATACGG + Intronic
1199772020 X:150981189-150981211 GCCTGCCATGAACTATCTGAAGG + Intronic
1200487722 Y:3788256-3788278 GGCTGCCATTTTCTATTGTAAGG - Intergenic
1200972608 Y:9170789-9170811 GGCTATCGTTGACTATATTACGG + Intergenic
1202356409 Y:24054781-24054803 GGCTATCATTGACTATATTGTGG + Intergenic
1202514369 Y:25615328-25615350 GGCTATCATTGACTATATTGTGG - Intergenic