ID: 1051826643

View in Genome Browser
Species Human (GRCh38)
Location 9:21229042-21229064
Sequence ATGGCAGCCCAAATATATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051826640_1051826643 24 Left 1051826640 9:21228995-21229017 CCTGAAGAACTGAGGATCAAACA 0: 5
1: 0
2: 0
3: 34
4: 222
Right 1051826643 9:21229042-21229064 ATGGCAGCCCAAATATATGCAGG No data
1051826642_1051826643 -9 Left 1051826642 9:21229028-21229050 CCATAAGATAGTCAATGGCAGCC 0: 3
1: 2
2: 1
3: 9
4: 83
Right 1051826643 9:21229042-21229064 ATGGCAGCCCAAATATATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051826643 Original CRISPR ATGGCAGCCCAAATATATGC AGG Intronic
No off target data available for this crispr