ID: 1051835728

View in Genome Browser
Species Human (GRCh38)
Location 9:21335392-21335414
Sequence GTCCCAGGATACCACGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 98}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051835713_1051835728 17 Left 1051835713 9:21335352-21335374 CCTAGCCCCAACACCGAGCCGCT 0: 1
1: 0
2: 0
3: 5
4: 124
Right 1051835728 9:21335392-21335414 GTCCCAGGATACCACGGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1051835722_1051835728 -10 Left 1051835722 9:21335379-21335401 CCGGAAAAGCCTAGTCCCAGGAT 0: 1
1: 0
2: 2
3: 10
4: 119
Right 1051835728 9:21335392-21335414 GTCCCAGGATACCACGGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1051835714_1051835728 12 Left 1051835714 9:21335357-21335379 CCCCAACACCGAGCCGCTCCTTC 0: 1
1: 0
2: 1
3: 1
4: 173
Right 1051835728 9:21335392-21335414 GTCCCAGGATACCACGGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1051835711_1051835728 30 Left 1051835711 9:21335339-21335361 CCTAGAATACCGGCCTAGCCCCA 0: 1
1: 0
2: 0
3: 4
4: 45
Right 1051835728 9:21335392-21335414 GTCCCAGGATACCACGGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1051835715_1051835728 11 Left 1051835715 9:21335358-21335380 CCCAACACCGAGCCGCTCCTTCC 0: 1
1: 0
2: 0
3: 10
4: 91
Right 1051835728 9:21335392-21335414 GTCCCAGGATACCACGGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1051835720_1051835728 -6 Left 1051835720 9:21335375-21335397 CCTTCCGGAAAAGCCTAGTCCCA 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1051835728 9:21335392-21335414 GTCCCAGGATACCACGGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1051835712_1051835728 21 Left 1051835712 9:21335348-21335370 CCGGCCTAGCCCCAACACCGAGC 0: 1
1: 0
2: 1
3: 15
4: 149
Right 1051835728 9:21335392-21335414 GTCCCAGGATACCACGGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1051835716_1051835728 10 Left 1051835716 9:21335359-21335381 CCAACACCGAGCCGCTCCTTCCG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1051835728 9:21335392-21335414 GTCCCAGGATACCACGGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1051835718_1051835728 4 Left 1051835718 9:21335365-21335387 CCGAGCCGCTCCTTCCGGAAAAG 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1051835728 9:21335392-21335414 GTCCCAGGATACCACGGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1051835719_1051835728 -1 Left 1051835719 9:21335370-21335392 CCGCTCCTTCCGGAAAAGCCTAG 0: 1
1: 0
2: 1
3: 6
4: 109
Right 1051835728 9:21335392-21335414 GTCCCAGGATACCACGGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051835728 Original CRISPR GTCCCAGGATACCACGGGGT GGG Intergenic
900625423 1:3606296-3606318 GGCCCAGCATTCCTCGGGGTGGG + Intronic
900708593 1:4096144-4096166 GTCCCAGGATTCCAGGGTGATGG - Intergenic
900972074 1:5997243-5997265 GTCCCAGGAAACCACGCAGAAGG - Intronic
901497433 1:9629978-9630000 CGCCCAGGACACCACGAGGTTGG + Intergenic
904437049 1:30505850-30505872 GTCACAGAATACCACGGATTGGG - Intergenic
912596332 1:110880517-110880539 GTCACAGGATACCAGGATGTTGG + Intronic
914802383 1:150971152-150971174 TTCCCAGGAGAACAAGGGGTGGG - Intronic
917791587 1:178502614-178502636 GTCCCAGGATCTCGCAGGGTAGG - Intergenic
920660562 1:207911030-207911052 GGCCCAGGATGCCGCGGGGCTGG - Exonic
922869990 1:228894561-228894583 GTCCAAGGACACCACAGGGCTGG + Intergenic
1062961977 10:1579034-1579056 GGATCAGGATACCACGAGGTGGG + Intronic
1063387137 10:5623120-5623142 GTCCCAGGGAGCCACGGGCTGGG - Intergenic
1063541592 10:6939540-6939562 ATCCCAGGAAACCACTGTGTGGG + Intergenic
1075242969 10:120794552-120794574 GTTCCAGGACACCACTGGGCTGG + Intergenic
1075442506 10:122491294-122491316 GTCCCATCAAACCACGGGGCCGG - Intronic
1075754720 10:124801747-124801769 TTCCCATGATGCCAAGGGGTCGG + Intergenic
1085350698 11:75796378-75796400 GGCCCATGATACCATGGGGGTGG - Exonic
1085529674 11:77183943-77183965 TTCCCAGGACCCCACGGAGTGGG - Intronic
1088815282 11:113416637-113416659 GGCCCAGGACACAACGGAGTTGG - Intronic
1098001851 12:65952932-65952954 GTTCCAGCATACCACTGGATAGG - Intronic
1101523596 12:105507249-105507271 GCTCCAGGATACCACTGGGGTGG - Intergenic
1103850240 12:123928320-123928342 GTCTCTGGAGAGCACGGGGTTGG + Exonic
1105501860 13:20979943-20979965 GTACCTGGATACTACTGGGTGGG + Intronic
1107044675 13:35982137-35982159 GGCCCAGGATCCCTCCGGGTGGG - Intronic
1114532794 14:23405904-23405926 GTCCCAGGGGACATCGGGGTAGG - Intronic
1116432840 14:44866674-44866696 TACCCAGGATACCTTGGGGTAGG + Intergenic
1121615640 14:95311769-95311791 GTCCCATGAACCCACAGGGTAGG - Intronic
1121645598 14:95515750-95515772 GTCCCAGGAAAGCCCAGGGTTGG + Intergenic
1122623838 14:103074269-103074291 GTCCCAGGACAGCACTGGGGCGG - Intergenic
1122694813 14:103547385-103547407 GTCCCAGGCTTCCCCTGGGTTGG - Intergenic
1202865574 14_GL000225v1_random:114949-114971 GCCCCAGGCTTCCACGGGGAGGG + Intergenic
1126216956 15:46166516-46166538 ATCCCAGGATGCCACAGGGGTGG - Intergenic
1127670650 15:61191490-61191512 GTCCCAGGACACCACAAGGCTGG + Intronic
1129739765 15:77984628-77984650 GACCCAGGACACCTGGGGGTGGG - Intronic
1129846010 15:78768011-78768033 GACCCAGGATGCCTGGGGGTGGG + Intronic
1130255864 15:82325852-82325874 GACCCAGGATGCCTGGGGGTGGG - Intergenic
1130599097 15:85264134-85264156 GACCCAGGATGCCTGGGGGTGGG + Intergenic
1132806526 16:1777607-1777629 GCCCCAGGGTCCCAGGGGGTGGG - Intronic
1136582218 16:31159920-31159942 GTCCCTGGAGACCAAGAGGTGGG - Intergenic
1136989877 16:35145581-35145603 GTCCCAGCATGCACCGGGGTTGG + Intergenic
1140216878 16:73015768-73015790 GCCCCAGGCTACCACGGAGGCGG - Intronic
1148196823 17:45720008-45720030 CTCCCAGGAAACCACAGTGTGGG + Intergenic
1151328690 17:73394182-73394204 GTCCCGGGATCCCAGGAGGTGGG - Intronic
1156491433 18:37498644-37498666 GTCCCATGTTACCACTGTGTAGG - Intronic
1157258480 18:46158702-46158724 GCCCCAGGCTACAAGGGGGTGGG - Intergenic
1161039165 19:2100823-2100845 GACCGAGGCCACCACGGGGTGGG + Intergenic
1161584226 19:5096466-5096488 GTCCCAGGTCTCCACGGGCTTGG + Intronic
1162396967 19:10422863-10422885 GTCCTAAGACACCAAGGGGTGGG + Intronic
1162574277 19:11489800-11489822 GGCCCAGGATACCACAGCGTGGG - Intronic
1163367431 19:16883589-16883611 GTCTCAGGAGGCCAGGGGGTGGG + Intergenic
1163374331 19:16921190-16921212 GTGCCAGGATCCCAGGGAGTGGG - Intronic
1167077980 19:47260603-47260625 GTCCCAGGAGACCTCCGGGAAGG - Exonic
926629402 2:15123089-15123111 CTCCCAGGCTACCTCGGGGTGGG - Intergenic
927464052 2:23323969-23323991 GTCCCTGGAGACCAGGGGGTGGG - Intergenic
932498770 2:72161612-72161634 GCCTCAGGAAACCATGGGGTAGG + Intergenic
936063648 2:109314166-109314188 GTCCCGGGAGACCAGCGGGTGGG + Intronic
938022775 2:127919801-127919823 GTCCCAGGATACCAGTGGAAAGG + Intergenic
943668080 2:190631758-190631780 GTCCAAAGATACCATGGGCTGGG + Intergenic
945276418 2:207991839-207991861 TTCACAGGATACCCAGGGGTAGG - Intronic
948462011 2:238134339-238134361 GTCCCAGGAGAGCCTGGGGTGGG + Intergenic
948923701 2:241080855-241080877 GTCCAGGGTGACCACGGGGTAGG + Intronic
1170045130 20:12077014-12077036 GTGGCAGGATACCACAAGGTAGG + Intergenic
1172888914 20:38249837-38249859 CTCCCAGGATTGCATGGGGTGGG - Intronic
1172950393 20:38719802-38719824 GCCCCAGGATACTTGGGGGTGGG + Intergenic
1173589966 20:44217033-44217055 GTCCCATGGGACAACGGGGTCGG - Intergenic
1176414671 21:6467683-6467705 GTCCCAGGCTGCGGCGGGGTGGG - Intergenic
1179107938 21:38420186-38420208 GTGCCTGGATACCATGGGGATGG + Intronic
1179690171 21:43076005-43076027 GTCCCAGGCTGCGGCGGGGTGGG - Intronic
1180073782 21:45451485-45451507 TTTCCGGGATCCCACGGGGTTGG + Intronic
1181583260 22:23839310-23839332 GACCCACGACACCACGGGGGCGG + Intergenic
1183376318 22:37467551-37467573 GTCCCAGAATAGCTGGGGGTAGG - Intergenic
1185301199 22:50081995-50082017 GACCCAGGACAGCACGGGGCGGG + Intronic
949865467 3:8543323-8543345 GACACAGGATACCCCAGGGTTGG - Intronic
954918177 3:54166075-54166097 GTGCCAGGAACCCACGAGGTGGG + Intronic
962853848 3:139327352-139327374 TTGCCAGGCTACCACGGGGAGGG + Intronic
966911171 3:184561345-184561367 GTCACAGGATACATCGCGGTGGG + Intronic
968850617 4:3075126-3075148 GTCCCAGGCTACGGCGGGGATGG + Intronic
968923052 4:3532483-3532505 TTCCCAGGAGACCGCGCGGTGGG - Exonic
971898527 4:32627661-32627683 GTGCCAGGGTCCAACGGGGTGGG - Intergenic
972643149 4:40943520-40943542 ATCCCAGGATCCAACTGGGTGGG + Intronic
988721266 5:33881441-33881463 CTGCCAGAATACCACGTGGTGGG - Exonic
996321542 5:122222552-122222574 GTCTCTGGATTCCAGGGGGTGGG - Intergenic
997369402 5:133348514-133348536 GTCCCAGGATGCCATGGGAAAGG + Intronic
997725974 5:136120123-136120145 GTCCCAGGCTAGCCTGGGGTCGG + Intergenic
997792473 5:136772982-136773004 GTCCCGGGACACGAGGGGGTAGG - Intergenic
997856674 5:137378960-137378982 TTCCCAGGGCTCCACGGGGTTGG + Intronic
1002712651 5:181204550-181204572 GTCCCGGGGACCCACGGGGTGGG + Intronic
1022343097 7:29486755-29486777 CCTCCAGGATAGCACGGGGTGGG - Intronic
1023477736 7:40599215-40599237 GCCACAGGATACCATAGGGTTGG + Intronic
1025019413 7:55468776-55468798 GCCCCAGGGTACCACGGGACAGG + Intronic
1036072532 8:5457054-5457076 CTCCCTGAAAACCACGGGGTGGG - Intergenic
1039389705 8:37168261-37168283 GTCCCTGGATACCACCTGGGAGG + Intergenic
1040356723 8:46625586-46625608 GTCCCAGAATACCTCTGGATTGG + Intergenic
1044404918 8:91816605-91816627 GGCACAGGAGACCACGGAGTGGG - Intergenic
1047075830 8:121401637-121401659 GTTCCAGGATCCCACCGGGCTGG + Intergenic
1049546349 8:143233232-143233254 GGCCCAGGAGACCCAGGGGTGGG + Intergenic
1051835728 9:21335392-21335414 GTCCCAGGATACCACGGGGTGGG + Intergenic
1053149297 9:35732546-35732568 GTCCCACAGTGCCACGGGGTGGG + Exonic
1056581278 9:87889352-87889374 TTCCCAGGCTACCACGGGGCAGG - Intergenic
1059731453 9:117061017-117061039 TTACCAGCATACCACTGGGTTGG + Intronic
1187473856 X:19592429-19592451 GTCACAGGAAATCACCGGGTGGG + Intronic
1192522496 X:71814791-71814813 TTCCCAGAATGCCCCGGGGTAGG - Intergenic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic