ID: 1051840827

View in Genome Browser
Species Human (GRCh38)
Location 9:21396183-21396205
Sequence GCTTGGGGATTAGGGTCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 83}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051840827_1051840835 -2 Left 1051840827 9:21396183-21396205 CCTGCGGACCCTAATCCCCAAGC 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1051840835 9:21396204-21396226 GCGCCCGGGCCTCCACTCTGCGG 0: 1
1: 0
2: 2
3: 13
4: 164
1051840827_1051840844 23 Left 1051840827 9:21396183-21396205 CCTGCGGACCCTAATCCCCAAGC 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 62
1051840827_1051840840 11 Left 1051840827 9:21396183-21396205 CCTGCGGACCCTAATCCCCAAGC 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1051840840 9:21396217-21396239 CACTCTGCGGACCCCAAGCGCGG 0: 1
1: 0
2: 1
3: 4
4: 49
1051840827_1051840847 28 Left 1051840827 9:21396183-21396205 CCTGCGGACCCTAATCCCCAAGC 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1051840847 9:21396234-21396256 GCGCGGGTCTCCTTGAGGAAGGG 0: 1
1: 0
2: 0
3: 2
4: 81
1051840827_1051840848 29 Left 1051840827 9:21396183-21396205 CCTGCGGACCCTAATCCCCAAGC 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1051840848 9:21396235-21396257 CGCGGGTCTCCTTGAGGAAGGGG 0: 1
1: 0
2: 0
3: 8
4: 86
1051840827_1051840846 27 Left 1051840827 9:21396183-21396205 CCTGCGGACCCTAATCCCCAAGC 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1051840846 9:21396233-21396255 AGCGCGGGTCTCCTTGAGGAAGG 0: 1
1: 0
2: 4
3: 36
4: 236
1051840827_1051840841 12 Left 1051840827 9:21396183-21396205 CCTGCGGACCCTAATCCCCAAGC 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1051840841 9:21396218-21396240 ACTCTGCGGACCCCAAGCGCGGG 0: 1
1: 0
2: 1
3: 4
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051840827 Original CRISPR GCTTGGGGATTAGGGTCCGC AGG (reversed) Intergenic