ID: 1051840830

View in Genome Browser
Species Human (GRCh38)
Location 9:21396191-21396213
Sequence GCCCGGGCGCTTGGGGATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 60}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051840830_1051840841 4 Left 1051840830 9:21396191-21396213 CCCTAATCCCCAAGCGCCCGGGC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1051840841 9:21396218-21396240 ACTCTGCGGACCCCAAGCGCGGG 0: 1
1: 0
2: 1
3: 4
4: 88
1051840830_1051840840 3 Left 1051840830 9:21396191-21396213 CCCTAATCCCCAAGCGCCCGGGC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1051840840 9:21396217-21396239 CACTCTGCGGACCCCAAGCGCGG 0: 1
1: 0
2: 1
3: 4
4: 49
1051840830_1051840847 20 Left 1051840830 9:21396191-21396213 CCCTAATCCCCAAGCGCCCGGGC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1051840847 9:21396234-21396256 GCGCGGGTCTCCTTGAGGAAGGG 0: 1
1: 0
2: 0
3: 2
4: 81
1051840830_1051840835 -10 Left 1051840830 9:21396191-21396213 CCCTAATCCCCAAGCGCCCGGGC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1051840835 9:21396204-21396226 GCGCCCGGGCCTCCACTCTGCGG 0: 1
1: 0
2: 2
3: 13
4: 164
1051840830_1051840850 30 Left 1051840830 9:21396191-21396213 CCCTAATCCCCAAGCGCCCGGGC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1051840850 9:21396244-21396266 CCTTGAGGAAGGGGCGACCGCGG 0: 1
1: 0
2: 1
3: 42
4: 322
1051840830_1051840848 21 Left 1051840830 9:21396191-21396213 CCCTAATCCCCAAGCGCCCGGGC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1051840848 9:21396235-21396257 CGCGGGTCTCCTTGAGGAAGGGG 0: 1
1: 0
2: 0
3: 8
4: 86
1051840830_1051840846 19 Left 1051840830 9:21396191-21396213 CCCTAATCCCCAAGCGCCCGGGC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1051840846 9:21396233-21396255 AGCGCGGGTCTCCTTGAGGAAGG 0: 1
1: 0
2: 4
3: 36
4: 236
1051840830_1051840844 15 Left 1051840830 9:21396191-21396213 CCCTAATCCCCAAGCGCCCGGGC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051840830 Original CRISPR GCCCGGGCGCTTGGGGATTA GGG (reversed) Intergenic