ID: 1051840839

View in Genome Browser
Species Human (GRCh38)
Location 9:21396216-21396238
Sequence CGCGCTTGGGGTCCGCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051840839_1051840850 5 Left 1051840839 9:21396216-21396238 CCACTCTGCGGACCCCAAGCGCG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1051840850 9:21396244-21396266 CCTTGAGGAAGGGGCGACCGCGG 0: 1
1: 0
2: 1
3: 42
4: 322
1051840839_1051840846 -6 Left 1051840839 9:21396216-21396238 CCACTCTGCGGACCCCAAGCGCG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1051840846 9:21396233-21396255 AGCGCGGGTCTCCTTGAGGAAGG 0: 1
1: 0
2: 4
3: 36
4: 236
1051840839_1051840848 -4 Left 1051840839 9:21396216-21396238 CCACTCTGCGGACCCCAAGCGCG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1051840848 9:21396235-21396257 CGCGGGTCTCCTTGAGGAAGGGG 0: 1
1: 0
2: 0
3: 8
4: 86
1051840839_1051840847 -5 Left 1051840839 9:21396216-21396238 CCACTCTGCGGACCCCAAGCGCG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1051840847 9:21396234-21396256 GCGCGGGTCTCCTTGAGGAAGGG 0: 1
1: 0
2: 0
3: 2
4: 81
1051840839_1051840857 23 Left 1051840839 9:21396216-21396238 CCACTCTGCGGACCCCAAGCGCG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1051840857 9:21396262-21396284 CGCGGGTTAGGGTCGCTGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 22
1051840839_1051840853 12 Left 1051840839 9:21396216-21396238 CCACTCTGCGGACCCCAAGCGCG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1051840853 9:21396251-21396273 GAAGGGGCGACCGCGGGTTAGGG 0: 1
1: 0
2: 0
3: 3
4: 41
1051840839_1051840851 6 Left 1051840839 9:21396216-21396238 CCACTCTGCGGACCCCAAGCGCG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1051840851 9:21396245-21396267 CTTGAGGAAGGGGCGACCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 104
1051840839_1051840844 -10 Left 1051840839 9:21396216-21396238 CCACTCTGCGGACCCCAAGCGCG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 62
1051840839_1051840856 22 Left 1051840839 9:21396216-21396238 CCACTCTGCGGACCCCAAGCGCG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1051840856 9:21396261-21396283 CCGCGGGTTAGGGTCGCTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 53
1051840839_1051840852 11 Left 1051840839 9:21396216-21396238 CCACTCTGCGGACCCCAAGCGCG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1051840852 9:21396250-21396272 GGAAGGGGCGACCGCGGGTTAGG 0: 1
1: 0
2: 1
3: 6
4: 81
1051840839_1051840854 19 Left 1051840839 9:21396216-21396238 CCACTCTGCGGACCCCAAGCGCG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1051840854 9:21396258-21396280 CGACCGCGGGTTAGGGTCGCTGG 0: 1
1: 0
2: 0
3: 0
4: 13

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051840839 Original CRISPR CGCGCTTGGGGTCCGCAGAG TGG (reversed) Intergenic