ID: 1051840844

View in Genome Browser
Species Human (GRCh38)
Location 9:21396229-21396251
Sequence CCCAAGCGCGGGTCTCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 62}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051840827_1051840844 23 Left 1051840827 9:21396183-21396205 CCTGCGGACCCTAATCCCCAAGC 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 62
1051840839_1051840844 -10 Left 1051840839 9:21396216-21396238 CCACTCTGCGGACCCCAAGCGCG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 62
1051840837_1051840844 -2 Left 1051840837 9:21396208-21396230 CCGGGCCTCCACTCTGCGGACCC 0: 1
1: 0
2: 1
3: 18
4: 269
Right 1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 62
1051840832_1051840844 8 Left 1051840832 9:21396198-21396220 CCCCAAGCGCCCGGGCCTCCACT 0: 1
1: 0
2: 1
3: 8
4: 118
Right 1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 62
1051840838_1051840844 -7 Left 1051840838 9:21396213-21396235 CCTCCACTCTGCGGACCCCAAGC 0: 1
1: 0
2: 2
3: 17
4: 149
Right 1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 62
1051840834_1051840844 6 Left 1051840834 9:21396200-21396222 CCAAGCGCCCGGGCCTCCACTCT 0: 1
1: 0
2: 1
3: 17
4: 182
Right 1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 62
1051840830_1051840844 15 Left 1051840830 9:21396191-21396213 CCCTAATCCCCAAGCGCCCGGGC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 62
1051840836_1051840844 -1 Left 1051840836 9:21396207-21396229 CCCGGGCCTCCACTCTGCGGACC 0: 1
1: 0
2: 0
3: 28
4: 399
Right 1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 62
1051840831_1051840844 14 Left 1051840831 9:21396192-21396214 CCTAATCCCCAAGCGCCCGGGCC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 62
1051840833_1051840844 7 Left 1051840833 9:21396199-21396221 CCCAAGCGCCCGGGCCTCCACTC 0: 1
1: 0
2: 1
3: 12
4: 148
Right 1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051840844 Original CRISPR CCCAAGCGCGGGTCTCCTTG AGG Intergenic