ID: 1051840844

View in Genome Browser
Species Human (GRCh38)
Location 9:21396229-21396251
Sequence CCCAAGCGCGGGTCTCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 62}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051840832_1051840844 8 Left 1051840832 9:21396198-21396220 CCCCAAGCGCCCGGGCCTCCACT 0: 1
1: 0
2: 1
3: 8
4: 118
Right 1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 62
1051840836_1051840844 -1 Left 1051840836 9:21396207-21396229 CCCGGGCCTCCACTCTGCGGACC 0: 1
1: 0
2: 0
3: 28
4: 399
Right 1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 62
1051840830_1051840844 15 Left 1051840830 9:21396191-21396213 CCCTAATCCCCAAGCGCCCGGGC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 62
1051840838_1051840844 -7 Left 1051840838 9:21396213-21396235 CCTCCACTCTGCGGACCCCAAGC 0: 1
1: 0
2: 2
3: 17
4: 149
Right 1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 62
1051840831_1051840844 14 Left 1051840831 9:21396192-21396214 CCTAATCCCCAAGCGCCCGGGCC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 62
1051840839_1051840844 -10 Left 1051840839 9:21396216-21396238 CCACTCTGCGGACCCCAAGCGCG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 62
1051840827_1051840844 23 Left 1051840827 9:21396183-21396205 CCTGCGGACCCTAATCCCCAAGC 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 62
1051840837_1051840844 -2 Left 1051840837 9:21396208-21396230 CCGGGCCTCCACTCTGCGGACCC 0: 1
1: 0
2: 1
3: 18
4: 269
Right 1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 62
1051840833_1051840844 7 Left 1051840833 9:21396199-21396221 CCCAAGCGCCCGGGCCTCCACTC 0: 1
1: 0
2: 1
3: 12
4: 148
Right 1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 62
1051840834_1051840844 6 Left 1051840834 9:21396200-21396222 CCAAGCGCCCGGGCCTCCACTCT 0: 1
1: 0
2: 1
3: 17
4: 182
Right 1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051840844 Original CRISPR CCCAAGCGCGGGTCTCCTTG AGG Intergenic
900115406 1:1025878-1025900 CCCAACCCCGGGGCTCCTGGTGG + Intronic
900537935 1:3187976-3187998 CCCAAGGTCGGGTCACCTTCGGG + Intronic
904602218 1:31679906-31679928 ACCAAGCGCGGGGCTGCGTGGGG + Intronic
906672729 1:47668489-47668511 CCCAAGTGAGGTTCACCTTGAGG - Intergenic
913406883 1:118504251-118504273 CCCAAGCCCGGGCCTCCCTAAGG + Intergenic
917974478 1:180230104-180230126 CCGAAGGGCGGGCCTCCCTGCGG + Intergenic
920262272 1:204697015-204697037 CCCTAGCCCTGGACTCCTTGGGG - Intergenic
921314373 1:213876424-213876446 CCCCTGCCCGAGTCTCCTTGAGG - Intergenic
1065727042 10:28677140-28677162 CCCCAGCGCGGGGCTTCTTTTGG - Intergenic
1067775766 10:49163877-49163899 CCCAAGCGCATGACTCCATGAGG + Intronic
1076726546 10:132416645-132416667 CCCAGGCTCGGGTCTCCACGGGG + Intronic
1081991152 11:47338358-47338380 CCCCAGAGCGGGGCTCCTTTTGG + Intronic
1083142038 11:60729976-60729998 CCAAACCATGGGTCTCCTTGGGG - Intronic
1086980965 11:93197681-93197703 GCCAAGCGCGGGGCCCCTGGAGG + Intronic
1092302515 12:7265375-7265397 CCCAAGCGCAGTGTTCCTTGTGG - Intergenic
1096007529 12:48184608-48184630 CCCCTGTGCTGGTCTCCTTGGGG + Exonic
1108498636 13:51048567-51048589 CCCACTAGCTGGTCTCCTTGAGG + Intergenic
1112752426 13:102596736-102596758 CCCAAGCGCGGGCCTCTTCAAGG + Intergenic
1115001099 14:28420619-28420641 CCCTGGCGCCGGTCTCCTTGAGG + Intergenic
1116707338 14:48318963-48318985 CCCCAGCCTGGGTCTCCCTGTGG - Intergenic
1119379493 14:74219509-74219531 CCCAGGCGCGGGTTTCCAGGAGG + Intergenic
1129953460 15:79612148-79612170 CCAAATGGCTGGTCTCCTTGAGG - Intergenic
1132852462 16:2031008-2031030 CCCAAGCGCGGTTCTCACAGTGG - Intronic
1147636457 17:41967187-41967209 CCCCAGCGCGGGCCTGCGTGGGG - Intronic
1147911171 17:43857180-43857202 CCCAAGCTCAGATCCCCTTGGGG + Intronic
1151219834 17:72604222-72604244 CCCTACTGCGGGTCTCCCTGGGG + Intergenic
1161473489 19:4472696-4472718 CCCGAGGGCGGGGCTCCCTGAGG - Intronic
1161645531 19:5451212-5451234 CCCAAGCCTGGGGCTCCTTGAGG + Intergenic
1163586934 19:18169309-18169331 CCCAGGGGCGGCTCTGCTTGGGG - Exonic
1163702533 19:18793349-18793371 CCCAAGAGCTTGTCACCTTGAGG - Intergenic
1167244030 19:48363356-48363378 CCCAGTCGCGGGGCTCCCTGGGG + Exonic
941905641 2:170715003-170715025 CCCAAGCGCGGGTCTCCAGGCGG + Intergenic
942308590 2:174632981-174633003 CCCAAGTGCGTGTCTCCTACAGG + Intronic
1169331262 20:4718169-4718191 CCCAGCCGCGAGTCTCCATGTGG - Intergenic
1175991766 20:62793419-62793441 GCCAAGCGTGTGTCTCCATGTGG + Intergenic
1179225065 21:39445775-39445797 CCCGCGCGCGGGTTTCCATGGGG - Intronic
1179428822 21:41304519-41304541 GCCAGGCTCGGGTCTCCTAGGGG - Intronic
1180149709 21:45941269-45941291 CCCAAGCACGGGTCCCAGTGGGG - Intronic
1180988097 22:19917449-19917471 CCCCAGGGCGGGTCTTCCTGGGG - Intronic
1183828224 22:40404864-40404886 CCCAAGCCCGGGTCCACTTCAGG + Intronic
954644377 3:52122015-52122037 CCCAAACGTGGGGCTCCTAGAGG - Intronic
968229636 3:196997657-196997679 CCCAAGCCCTGGACACCTTGGGG + Intronic
968506074 4:972078-972100 CCCACGCTTGGGTCTCCTGGCGG + Intronic
982990106 4:162263222-162263244 CCCTGGCGCCGGGCTCCTTGAGG + Intergenic
984774289 4:183467215-183467237 CCCTAGCGAGGTTCTCCATGAGG - Intergenic
985559197 5:573984-574006 CCCAGGCCCGGCTCTCCCTGGGG - Intergenic
985640101 5:1059590-1059612 CCCAAGGGCAGGTGTCTTTGTGG - Intronic
988655703 5:33209455-33209477 CCCTGGCGCTGGGCTCCTTGAGG + Intergenic
992549176 5:77845017-77845039 CCCACGCGCGCGCCTCCTCGTGG + Intronic
1003122575 6:3330043-3330065 CCCAAGCCCCGGTGTCCTAGTGG - Intronic
1017246903 6:152236858-152236880 CCCAAGCGTGGGTCTGGTGGAGG - Exonic
1018983421 6:168617412-168617434 CCCAAGGACGGGTCTCCCAGGGG + Intronic
1020077976 7:5271037-5271059 CCCAAGGTCGAGGCTCCTTGAGG - Intergenic
1021805903 7:24354647-24354669 CCCTAGTGCTGGGCTCCTTGAGG - Intergenic
1024242484 7:47446364-47446386 CCCAAGCTGTGGTTTCCTTGTGG + Intronic
1025094865 7:56089014-56089036 CCCAGGGGCTGTTCTCCTTGGGG + Intronic
1025200916 7:56961137-56961159 CCCAAGGTCGAGGCTCCTTGAGG + Intergenic
1025671027 7:63615795-63615817 CCCAAGGTCGAGGCTCCTTGAGG - Intergenic
1033757027 7:144403951-144403973 CCCAGGTGCGGGTCTCCTTCAGG + Intronic
1049384328 8:142333603-142333625 CCCAAGCCCAGCTCTGCTTGGGG + Intronic
1049557605 8:143290979-143291001 CCCGAGCGTGGGCTTCCTTGGGG - Intronic
1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG + Intergenic
1061631387 9:131874351-131874373 CCCAAGCTGTGCTCTCCTTGAGG + Intronic
1199815895 X:151396837-151396859 CATATGCTCGGGTCTCCTTGCGG + Intronic
1201305005 Y:12542489-12542511 CCCATGCTTGGGTCTCCTTCAGG - Intergenic
1201754793 Y:17475120-17475142 CCCAAGCACAGCTTTCCTTGTGG - Intergenic
1201846759 Y:18430865-18430887 CCCAAGCACAGCTTTCCTTGTGG + Intergenic