ID: 1051842664

View in Genome Browser
Species Human (GRCh38)
Location 9:21415976-21415998
Sequence CATCCTGTACTGATGGCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051842662_1051842664 9 Left 1051842662 9:21415944-21415966 CCGCTTGCGGTGATTTCATGTGA 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1051842664 9:21415976-21415998 CATCCTGTACTGATGGCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051842664 Original CRISPR CATCCTGTACTGATGGCACT AGG Intronic
No off target data available for this crispr