ID: 1051843761

View in Genome Browser
Species Human (GRCh38)
Location 9:21428593-21428615
Sequence CAAAGGTTACATTGTAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 214}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051843761_1051843768 24 Left 1051843761 9:21428593-21428615 CCCCCATTACAATGTAACCTTTG 0: 1
1: 0
2: 0
3: 15
4: 214
Right 1051843768 9:21428640-21428662 CAAGATCCATTTTACTCTGGAGG No data
1051843761_1051843767 21 Left 1051843761 9:21428593-21428615 CCCCCATTACAATGTAACCTTTG 0: 1
1: 0
2: 0
3: 15
4: 214
Right 1051843767 9:21428637-21428659 ATGCAAGATCCATTTTACTCTGG No data
1051843761_1051843765 -9 Left 1051843761 9:21428593-21428615 CCCCCATTACAATGTAACCTTTG 0: 1
1: 0
2: 0
3: 15
4: 214
Right 1051843765 9:21428607-21428629 TAACCTTTGCTGTAGCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051843761 Original CRISPR CAAAGGTTACATTGTAATGG GGG (reversed) Intronic
901138287 1:7011717-7011739 TAGAGGTTACACTGTAGTGGGGG - Intronic
901641915 1:10696931-10696953 CAAAGGCTACAGAGGAATGGCGG + Intronic
901725098 1:11235439-11235461 CCAAGGTTAGAGTGCAATGGTGG - Intronic
907367720 1:53976476-53976498 CAAAAGATACATTTTAAAGGTGG - Intergenic
907776284 1:57518995-57519017 CAAGGCTTACATTTTAGTGGGGG - Intronic
907889830 1:58626157-58626179 CAAAACTTACATTGTAGTTGGGG - Intergenic
908274007 1:62450241-62450263 CAAAGGTTTGATTGTTATGGTGG + Exonic
910234568 1:85022538-85022560 TAAAGCTTACATTCTAGTGGAGG + Intronic
910697432 1:90035489-90035511 AAAATGATACATTTTAATGGAGG + Intronic
910875119 1:91871459-91871481 CATAGGTTACCTTCTAAAGGTGG + Intronic
911617915 1:100035551-100035573 CAGAGCTTACATTCTAGTGGGGG - Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
916033170 1:160896325-160896347 CAAAAATCACATTCTAATGGGGG - Intergenic
917091390 1:171356997-171357019 CAAAGGTTACAGTTTACTGCCGG + Intergenic
917578381 1:176348471-176348493 CAAAGGTAACATTCTAAGGATGG + Intergenic
919083071 1:192889783-192889805 CAAAGGAAAAATTATAATGGTGG - Intergenic
919619455 1:199848439-199848461 AAAAGTTTACATTCTCATGGGGG - Intergenic
921145929 1:212356342-212356364 CAGAGCTTACGTTCTAATGGAGG - Intronic
923183827 1:231550277-231550299 CAAATGTTACTTTGGAGTGGAGG + Intronic
923519559 1:234725302-234725324 CAAAGGTTACTTAGAAGTGGAGG + Intergenic
1063745233 10:8871747-8871769 CGAAAGTGACATTGCAATGGGGG + Intergenic
1064277559 10:13920506-13920528 CAAAGGTTGTATTGTAATGTAGG - Intronic
1065589276 10:27249636-27249658 CAAAGGTTGAACTGTAATGCTGG + Intergenic
1065742312 10:28808129-28808151 TCAAGTTTACATTTTAATGGAGG - Intergenic
1066249987 10:33624065-33624087 CACAGGTTAATTTGTGATGGTGG - Intergenic
1070020395 10:72579413-72579435 GAAAGGGTAAATTGTAATGTTGG - Intronic
1070148037 10:73788896-73788918 CAAAGGAGACATTGTATTTGGGG + Intronic
1070241666 10:74688325-74688347 TGAAACTTACATTGTAATGGGGG - Intronic
1071416261 10:85444694-85444716 CAGAAATTACATAGTAATGGAGG - Intergenic
1071767580 10:88685935-88685957 CAGAGCTTACATTTTAGTGGTGG + Intergenic
1071969924 10:90893807-90893829 AAAAGCTTACATTTTAGTGGGGG - Intronic
1073971521 10:109049151-109049173 AAAAGATTACAGTGTAATGCTGG - Intergenic
1074621671 10:115131764-115131786 CAAAGGATAAAATATAATGGAGG - Intronic
1074652804 10:115543666-115543688 ATAACGTTACATTGTAATGCAGG - Intronic
1075862619 10:125690307-125690329 GAAAGGACACATTGTATTGGTGG - Intergenic
1078423449 11:11230780-11230802 CAAAAGTCACATTGTAAAGTGGG - Intergenic
1078866368 11:15301856-15301878 AAGAGGTCACATTCTAATGGTGG + Intergenic
1081255073 11:40882671-40882693 TAAATGTTACATTTTAAAGGAGG - Intronic
1083100029 11:60293472-60293494 CAAAGGTTACATGCTGGTGGAGG - Intronic
1085422927 11:76379760-76379782 TGAAGATTACATTCTAATGGGGG - Intronic
1087185864 11:95194272-95194294 CTCAGGTTACCTAGTAATGGGGG - Intronic
1087451911 11:98334381-98334403 CAATTGATAGATTGTAATGGTGG + Intergenic
1089580855 11:119481342-119481364 CAGAGATTACATCCTAATGGGGG - Intergenic
1092200297 12:6578019-6578041 CAAAGGATACTTTATAATGCCGG + Exonic
1092972348 12:13708921-13708943 TAAAGCTTAAATTCTAATGGTGG + Intronic
1093825528 12:23681974-23681996 AAAATGTTCCATTATAATGGGGG - Intronic
1095664414 12:44779328-44779350 CAAAGGTTATATTTCAGTGGTGG + Intronic
1096185807 12:49579845-49579867 CAAAGCTTACATTCTATGGGGGG - Intronic
1098158889 12:67628807-67628829 AAAAGCATACATTCTAATGGAGG + Intergenic
1098443705 12:70544921-70544943 CAGAGGTTACATTCTCATGGAGG + Intronic
1100922375 12:99502610-99502632 CCAAGGTTACATGTTAATGAGGG - Intronic
1101335677 12:103794489-103794511 CAAAGTTTCCATGGTGATGGTGG + Intronic
1101475576 12:105044062-105044084 CAAAGGTGCCATTGTTATGCTGG - Intronic
1101899207 12:108778757-108778779 CAAATGGTACATTGTGGTGGTGG - Intergenic
1103506668 12:121445664-121445686 CAGAGCTTACATTTTAGTGGAGG + Intronic
1103770329 12:123317668-123317690 CAAAGGTAACTTGGAAATGGAGG + Intronic
1104278546 12:127352885-127352907 CAAAGCTGACATTCTAGTGGAGG - Intergenic
1104428432 12:128696801-128696823 CAGAGGATACATTGTGGTGGTGG + Intronic
1106755951 13:32822694-32822716 CCAAGGTTACTTAGTAAAGGTGG + Intergenic
1107381703 13:39863443-39863465 CAATGGTAACACTGTAATGCAGG - Intergenic
1108128139 13:47267467-47267489 CAAAGTTTTCGATGTAATGGTGG - Intergenic
1112936276 13:104803714-104803736 CAAAAGCTACATTGAAATGAGGG + Intergenic
1113317646 13:109200203-109200225 CATAGGTTACGTTATAATGAAGG - Intronic
1113357239 13:109592629-109592651 CAAAGGGTACATTTTAATGATGG + Intergenic
1114040903 14:18677522-18677544 CAAAGGTTAATATGTAATTGGGG - Intergenic
1114045940 14:18876009-18876031 CAAAGGTTAATATGTAATTGGGG - Intergenic
1114118274 14:19643457-19643479 CAAAGGTTAATATGTAATTGGGG + Intergenic
1115987841 14:39120953-39120975 CAAAGGTTATTTTGTTAAGGAGG + Intronic
1116876816 14:50120510-50120532 GAAAGCTTACAATTTAATGGGGG - Intronic
1117183244 14:53213984-53214006 CTAGGGTCACATTGTAATGTAGG + Intergenic
1117491975 14:56257268-56257290 CAGAGCTTACAGTGTAATGTGGG + Intronic
1118506969 14:66423980-66424002 CAAAGCTTACATTCTAGTCGGGG - Intergenic
1119159214 14:72439194-72439216 CTAAGCTTACTCTGTAATGGAGG - Intronic
1121399437 14:93659649-93659671 CAAAGATTAAATTGGAAAGGTGG - Intronic
1122443436 14:101750549-101750571 CAAAACCTACATTCTAATGGGGG - Intergenic
1123057151 14:105575916-105575938 CTGAGGTTACATGGTGATGGGGG + Intergenic
1123081093 14:105695975-105695997 CTGAGGTTACATGGTGATGGGGG - Intergenic
1124712361 15:32025509-32025531 CAAAGGTGACATGGCAATGCAGG + Intergenic
1126377216 15:48008274-48008296 CAAAGGATAGAATGTATTGGTGG + Intergenic
1133635412 16:7660572-7660594 CCTAGGTTATATTCTAATGGAGG - Intronic
1134879505 16:17733055-17733077 CAAAGGGTACTTAGTAATGGTGG + Intergenic
1135331640 16:21565065-21565087 CAAAGCTTACATTCTGGTGGAGG - Intergenic
1137522476 16:49206566-49206588 CAAAGGTCACATTGGCAAGGTGG + Intergenic
1137762805 16:50954170-50954192 AAGAGCTTACATTCTAATGGGGG - Intergenic
1139624812 16:68178526-68178548 TAGAGCTTACATTGTAGTGGGGG + Intronic
1141439767 16:84022420-84022442 CAGATGTTACAGTGTAATGACGG + Intronic
1144128755 17:12225777-12225799 CGGAGGTTACATTGTAGTTGAGG + Intergenic
1146223619 17:31047912-31047934 CAAAGGTTGAACTGTAATGCTGG + Intergenic
1147392381 17:40118141-40118163 TGAAGTTTACATTGTAGTGGGGG + Intergenic
1147921999 17:43923386-43923408 CAAAGGTTGAACTGTAATGCTGG + Intergenic
1151778007 17:76221491-76221513 CAAAGAATATATTGTAAGGGGGG + Intronic
1156040650 18:32817222-32817244 CAAAGTTTTCAATTTAATGGAGG - Intergenic
1156954449 18:42944371-42944393 TGAAGCTTACATTGTAGTGGGGG - Intronic
1157784057 18:50466410-50466432 AAAAGGTTACATAGTGAAGGAGG - Intergenic
1158779832 18:60634722-60634744 CATAGAGTACATGGTAATGGTGG - Intergenic
1158894134 18:61897361-61897383 CAGAACTTACATTCTAATGGAGG + Intergenic
1159306211 18:66646192-66646214 CAATGGTTAAATTGAAATGTAGG - Intergenic
1162177265 19:8840215-8840237 CAAAGGTTACATTGCAATATTGG + Intronic
1164313940 19:24070309-24070331 CACAGGTGACATTGTGATGCTGG + Intronic
1167656529 19:50767948-50767970 CAAATGTTACATTCTTATCGGGG + Intergenic
926906534 2:17810983-17811005 GAAAGATTACATTTGAATGGAGG + Intergenic
929311602 2:40432285-40432307 CAGAGCTTATATTCTAATGGTGG + Intronic
930177874 2:48318162-48318184 CAAATGTACCATTGTAATGTAGG - Intronic
932118364 2:69075235-69075257 CATACGTTTCTTTGTAATGGGGG - Intronic
937140962 2:119599791-119599813 CACAGTTTACATTCTAGTGGGGG - Intronic
938269284 2:129954999-129955021 CAAAGGTTAATATGTAATTGGGG + Intergenic
938993762 2:136656112-136656134 CGAAGTTTAGATTGTAAAGGGGG + Intergenic
939530181 2:143349940-143349962 CTAAGTTTAAATTGAAATGGTGG - Intronic
945734146 2:213577142-213577164 TAAAGGGTACATTTTAATAGAGG + Intronic
946035394 2:216738173-216738195 CAAAGCTTATGTTTTAATGGGGG + Intergenic
948118666 2:235512774-235512796 CAAAGGTTACATGGTCAGGAGGG - Intronic
948324675 2:237104417-237104439 CAAAGGTAACATTGCAATACAGG + Intergenic
1172102788 20:32495588-32495610 CAAATTTTACATTTTGATGGAGG - Intronic
1172190035 20:33056402-33056424 CAGAGGTTACACTCAAATGGTGG - Intronic
1180464471 22:15598630-15598652 CAAAGGTTAATATGTAATTGGGG - Intergenic
1181322562 22:22019583-22019605 CAATGGTTGCATTGTGTTGGAGG + Intergenic
1181363166 22:22354352-22354374 AAAAGGTGACATTGAGATGGGGG - Intergenic
1183092616 22:35533194-35533216 CAAAGGTTCCATGGCAATGGAGG - Intergenic
949637397 3:5998060-5998082 AGAAGGTTACATGATAATGGAGG + Intergenic
949687943 3:6599592-6599614 CAAAGCATACATTGTAGTGTGGG + Intergenic
950961107 3:17108957-17108979 TGGAGGTTACATTCTAATGGGGG + Intergenic
952660817 3:35844630-35844652 CAAAGGTTTCATGGTCATGAAGG - Intergenic
954135899 3:48581996-48582018 CAAAGTCTTCATTGGAATGGAGG + Intronic
955636026 3:61030595-61030617 CAAAGTTTAGATTCTAGTGGTGG + Intronic
955712585 3:61795825-61795847 CAAAGGCCACTTTGTAATGGGGG - Intronic
956135074 3:66090256-66090278 TACAGTTTACATGGTAATGGGGG - Intergenic
957122783 3:76117732-76117754 CGAAGCTTACATTCTAGTGGGGG + Intronic
957791349 3:84944970-84944992 CAAAAGTTTCATAGTAATTGAGG - Intergenic
959544902 3:107584483-107584505 CTAACGTTACACTGTAATGATGG + Intronic
959561215 3:107784139-107784161 TCAAGATTACATTATAATGGGGG + Intronic
960280159 3:115772290-115772312 CGAAGCTTACATTTTCATGGAGG + Intergenic
960576063 3:119230771-119230793 CACAGGGCACATTGCAATGGGGG + Intronic
961552084 3:127675193-127675215 GAAAGGTCACTCTGTAATGGTGG - Intronic
963327593 3:143879436-143879458 CAAATTTTACATTTTAATAGAGG - Intergenic
963458050 3:145572516-145572538 TCAAGCTTACATTCTAATGGGGG + Intergenic
964642136 3:158920201-158920223 TAAAGGTTATTTTTTAATGGGGG - Intergenic
965222368 3:165942949-165942971 CTAAGCTTAGATTGTAATGATGG + Intergenic
966141089 3:176757110-176757132 TAAAGCTGACATTGTAATGTGGG + Intergenic
966339201 3:178906266-178906288 AAAAGGTTAAATTGTAATAGGGG - Intergenic
966815451 3:183886280-183886302 CAAAGATTCTATTGTATTGGGGG + Intergenic
966824234 3:183950370-183950392 CATAAGTTACTTTGTAAAGGGGG - Intronic
967295866 3:187964174-187964196 CACAGCTCACATTGTAATGCTGG - Intergenic
967582470 3:191176083-191176105 TAAAAGTTACATTTTAATTGAGG + Intergenic
967597787 3:191348151-191348173 CATAGGTGACATTTGAATGGGGG + Intronic
969044023 4:4323452-4323474 AAGAGGTTACATCGTAATAGGGG - Intergenic
972763610 4:42131380-42131402 CAATGATTACATTTTAATTGTGG + Intronic
974158926 4:58112021-58112043 GAAAGCTAACATTGTAATGTTGG - Intergenic
974939717 4:68451900-68451922 CAAAGGAGACATTGTGAGGGTGG - Intronic
975259205 4:72276402-72276424 TAGAGGGTACATTGTAGTGGAGG - Intergenic
975288115 4:72644413-72644435 GAAATGCTACATTGTTATGGTGG + Intergenic
978193125 4:105939146-105939168 CAAAGCTGACATGCTAATGGGGG + Intronic
979059104 4:116032440-116032462 CAAAAGTAATATTGTAATTGAGG - Intergenic
979213076 4:118130600-118130622 CTATGATAACATTGTAATGGTGG - Intronic
980145403 4:128977452-128977474 TAAAGTTCATATTGTAATGGAGG + Intronic
982324528 4:154116155-154116177 CATGTGTTACATTTTAATGGGGG + Intergenic
984681404 4:182614110-182614132 CATAGTTTACATTGTAATGTTGG + Intronic
986814988 5:11399064-11399086 CGAAGGTCACATTTTAATGGTGG + Intronic
987235329 5:15936489-15936511 CAAGGGTGACAGTTTAATGGAGG - Exonic
988852923 5:35197006-35197028 CAAAGGCTCCATTATATTGGGGG + Intronic
989567705 5:42917237-42917259 TAAAGTTTACATTGTAATAAGGG + Intergenic
991563619 5:67981896-67981918 AAAAGTTTACATTGTTATAGAGG + Intergenic
992341583 5:75829544-75829566 CAAAAGTTACTTTGGAATGCAGG + Intergenic
994078337 5:95678741-95678763 AAAAGGTTAGATTGTAAGTGCGG - Intronic
996343154 5:122460356-122460378 CCAAGATTACATAGTAATGATGG + Intronic
998602985 5:143604030-143604052 AAGAGTTTACATTCTAATGGAGG + Intergenic
999700770 5:154225703-154225725 CAAAGTTCACATTTTAATGGAGG + Intronic
999844795 5:155467570-155467592 CGAAGCTTATATTCTAATGGGGG - Intergenic
1002040453 5:176510020-176510042 AAAAGTTTACATTGTATTGTAGG + Exonic
1005295369 6:24420549-24420571 CGTAGGTTATATTGTAGTGGAGG + Intronic
1005694323 6:28336837-28336859 CAAAGGAGAGATGGTAATGGTGG + Exonic
1007163251 6:39809954-39809976 CAAAGGTTCCATTCTAAAGAAGG - Intronic
1007245744 6:40460988-40461010 CAAATGTTACATTACAATGATGG - Intronic
1008724135 6:54395315-54395337 CTAAGGTTACATTCTGATAGTGG - Intergenic
1010786715 6:80011064-80011086 CTAAGATTAAATTGTAAAGGAGG + Intronic
1011910613 6:92432902-92432924 CAAAGGTTAGATGGGAGTGGTGG - Intergenic
1014627809 6:123751067-123751089 CAGAGTTTACATTCTAGTGGGGG + Intergenic
1015303088 6:131676342-131676364 CAAAGATTACATTCTAATGCAGG - Intronic
1015512003 6:134047310-134047332 CAACTGTTGCATAGTAATGGAGG + Intronic
1016774270 6:147887345-147887367 CAGAGGTTGGATGGTAATGGGGG - Intergenic
1017896956 6:158688420-158688442 CAAAGCTCAGAATGTAATGGGGG - Intronic
1018195071 6:161348354-161348376 CAAAGCTCACATAGAAATGGTGG - Exonic
1020225185 7:6273756-6273778 AAAAGCAAACATTGTAATGGAGG + Intergenic
1021931649 7:25586797-25586819 CGAAGCTTACATTGTAGAGGAGG - Intergenic
1023111194 7:36812482-36812504 GAAGGGTTGCATTGGAATGGTGG - Intergenic
1023489470 7:40723242-40723264 CAAAGGTCACAAGGAAATGGTGG - Intronic
1023693489 7:42819160-42819182 TTAATGTTACAGTGTAATGGTGG + Intergenic
1023945994 7:44803697-44803719 CAAAAATTACATGGTCATGGTGG + Intronic
1028695451 7:93705618-93705640 CCCAGGTTACATTGTTCTGGTGG - Intronic
1030597411 7:111556575-111556597 CACTGGTTTCATTGTAGTGGTGG - Intronic
1030731011 7:112988941-112988963 CAAAAGTTTCATTATAATGGTGG - Intergenic
1032123851 7:129176435-129176457 CTAAGTTTACATTCTACTGGAGG + Intergenic
1032153538 7:129450302-129450324 GAAAGGCTACATGGTTATGGAGG - Intronic
1033160827 7:138995245-138995267 CAAAACTTAAATTTTAATGGTGG + Intergenic
1033631927 7:143166812-143166834 CTAAGATTTCATAGTAATGGTGG - Intergenic
1039407130 8:37322978-37323000 CAGAGATTACATTGTAAGAGAGG + Intergenic
1039704994 8:39997517-39997539 CAAAAATTAGATGGTAATGGTGG + Intronic
1043922173 8:85995921-85995943 CGAAACTTACATTTTAATGGAGG + Intronic
1045243628 8:100423957-100423979 CAGAGCTTACATTTTAGTGGGGG + Intergenic
1045406747 8:101874307-101874329 GAAGGTTTACATTTTAATGGAGG + Intronic
1045684507 8:104698524-104698546 CAAAGGTAATATTTTAATAGGGG + Intronic
1045847443 8:106655201-106655223 CAAAGATTACATTTTGATGATGG + Intronic
1047343657 8:124006555-124006577 CCAAGGTGACATTTTAATGGGGG - Intronic
1047658185 8:127002032-127002054 CAATGGTTACCTTTTGATGGTGG - Intergenic
1048225945 8:132585445-132585467 CAAAGCTTATATTGAAAGGGTGG - Intronic
1050068562 9:1786630-1786652 CAGAGTTTACATTCTAGTGGGGG - Intergenic
1051397552 9:16641698-16641720 TAAATGTTACATTTCAATGGGGG + Intronic
1051578158 9:18641028-18641050 CAAAGGTGAGATTGGAAAGGTGG - Intronic
1051843761 9:21428593-21428615 CAAAGGTTACATTGTAATGGGGG - Intronic
1055920187 9:81451974-81451996 CAAAAATTACCTGGTAATGGTGG + Intergenic
1057918724 9:99078580-99078602 CAAATGATACATTGTAGTGTAGG + Intergenic
1059047138 9:110881003-110881025 CTAAGGGTTCATTATAATGGGGG + Intronic
1060033054 9:120232158-120232180 CAAAACTTACATTTTCATGGTGG + Intergenic
1060864706 9:126986446-126986468 CAAGGGCTGCATTGTAAAGGAGG + Intronic
1185957544 X:4507936-4507958 CAAATATGACACTGTAATGGTGG - Intergenic
1187498729 X:19819824-19819846 TAAAGTTTACATTAGAATGGAGG - Intronic
1187704365 X:21994600-21994622 CAAAAATCACATTCTAATGGGGG - Exonic
1190976202 X:55403951-55403973 CACAGGTTACACAGCAATGGAGG - Intergenic
1193965758 X:87984064-87984086 TAAATCTTACATTGTAATGAAGG + Intergenic
1195044336 X:101042681-101042703 CAAAGGTTACAATCTAATTAAGG + Intronic
1195756299 X:108202325-108202347 TTGAGATTACATTGTAATGGGGG - Intronic
1197233894 X:124036847-124036869 CTAAAATTATATTGTAATGGTGG - Intronic
1198298235 X:135307963-135307985 CAAAGGATAAATTTTAATGAAGG + Intronic
1199235380 X:145486997-145487019 CAGAGATTACATTGTAAGAGAGG + Intergenic
1199903101 X:152196963-152196985 CAAAGGTATCATTGCCATGGAGG + Intronic
1202298587 Y:23386326-23386348 TAGGGGTTACATTCTAATGGAGG - Intergenic
1202572221 Y:26284273-26284295 TAGGGGTTACATTCTAATGGAGG + Intergenic