ID: 1051849596

View in Genome Browser
Species Human (GRCh38)
Location 9:21490973-21490995
Sequence CAGAGCAAAGAGCAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051849593_1051849596 4 Left 1051849593 9:21490946-21490968 CCTGAGGTCGTAGGTGGATCTTT 0: 290
1: 334
2: 165
3: 83
4: 108
Right 1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG No data
1051849589_1051849596 27 Left 1051849589 9:21490923-21490945 CCTTGGGCTGGTTGGTCTGAGGA 0: 181
1: 252
2: 97
3: 30
4: 183
Right 1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051849596 Original CRISPR CAGAGCAAAGAGCAGGAGGA TGG Intergenic
No off target data available for this crispr