ID: 1051850512

View in Genome Browser
Species Human (GRCh38)
Location 9:21501537-21501559
Sequence AAATAGACATTAATTAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051850512_1051850513 -6 Left 1051850512 9:21501537-21501559 CCACTTCTAATTAATGTCTATTT No data
Right 1051850513 9:21501554-21501576 CTATTTCTCATTAACATATCTGG No data
1051850512_1051850514 22 Left 1051850512 9:21501537-21501559 CCACTTCTAATTAATGTCTATTT No data
Right 1051850514 9:21501582-21501604 ACTAGAAAGTTACATACTGATGG No data
1051850512_1051850515 29 Left 1051850512 9:21501537-21501559 CCACTTCTAATTAATGTCTATTT No data
Right 1051850515 9:21501589-21501611 AGTTACATACTGATGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051850512 Original CRISPR AAATAGACATTAATTAGAAG TGG (reversed) Intergenic
No off target data available for this crispr