ID: 1051850514

View in Genome Browser
Species Human (GRCh38)
Location 9:21501582-21501604
Sequence ACTAGAAAGTTACATACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051850512_1051850514 22 Left 1051850512 9:21501537-21501559 CCACTTCTAATTAATGTCTATTT No data
Right 1051850514 9:21501582-21501604 ACTAGAAAGTTACATACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051850514 Original CRISPR ACTAGAAAGTTACATACTGA TGG Intergenic
No off target data available for this crispr