ID: 1051850515 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:21501589-21501611 |
| Sequence | AGTTACATACTGATGGTGAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1051850512_1051850515 | 29 | Left | 1051850512 | 9:21501537-21501559 | CCACTTCTAATTAATGTCTATTT | No data | ||
| Right | 1051850515 | 9:21501589-21501611 | AGTTACATACTGATGGTGAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1051850515 | Original CRISPR | AGTTACATACTGATGGTGAA AGG | Intergenic | ||
| No off target data available for this crispr | |||||