ID: 1051863684

View in Genome Browser
Species Human (GRCh38)
Location 9:21654532-21654554
Sequence GTGTATAGATAGATTTATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051863683_1051863684 5 Left 1051863683 9:21654504-21654526 CCAATAATATATCTATATATCTA No data
Right 1051863684 9:21654532-21654554 GTGTATAGATAGATTTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051863684 Original CRISPR GTGTATAGATAGATTTATTT TGG Intergenic
No off target data available for this crispr