ID: 1051873673

View in Genome Browser
Species Human (GRCh38)
Location 9:21768089-21768111
Sequence CTGTTTACCCAGTTGGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051873669_1051873673 -10 Left 1051873669 9:21768076-21768098 CCTATTGTGTATTCTGTTTACCC No data
Right 1051873673 9:21768089-21768111 CTGTTTACCCAGTTGGGTCTGGG No data
1051873668_1051873673 5 Left 1051873668 9:21768061-21768083 CCTGTACTTTAGTTTCCTATTGT No data
Right 1051873673 9:21768089-21768111 CTGTTTACCCAGTTGGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051873673 Original CRISPR CTGTTTACCCAGTTGGGTCT GGG Intergenic
No off target data available for this crispr