ID: 1051875501

View in Genome Browser
Species Human (GRCh38)
Location 9:21788804-21788826
Sequence CATTATACACAGAAATCCGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051875500_1051875501 -5 Left 1051875500 9:21788786-21788808 CCAAAGACAGGGACTTTTCATTA No data
Right 1051875501 9:21788804-21788826 CATTATACACAGAAATCCGACGG No data
1051875497_1051875501 27 Left 1051875497 9:21788754-21788776 CCAAGCTGAGCTTCATGTGGGAA No data
Right 1051875501 9:21788804-21788826 CATTATACACAGAAATCCGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051875501 Original CRISPR CATTATACACAGAAATCCGA CGG Intergenic
No off target data available for this crispr