ID: 1051876911

View in Genome Browser
Species Human (GRCh38)
Location 9:21802884-21802906
Sequence GTCCCTTGCCGCCGCGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 73}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051876889_1051876911 27 Left 1051876889 9:21802834-21802856 CCCCCGCGCCGGGGGACCGCGCC 0: 1
1: 0
2: 0
3: 19
4: 211
Right 1051876911 9:21802884-21802906 GTCCCTTGCCGCCGCGGGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 73
1051876892_1051876911 24 Left 1051876892 9:21802837-21802859 CCGCGCCGGGGGACCGCGCCTCC 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1051876911 9:21802884-21802906 GTCCCTTGCCGCCGCGGGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 73
1051876901_1051876911 3 Left 1051876901 9:21802858-21802880 CCGGGGGCCATGCGCCCGGCCCG 0: 1
1: 0
2: 1
3: 13
4: 224
Right 1051876911 9:21802884-21802906 GTCCCTTGCCGCCGCGGGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 73
1051876890_1051876911 26 Left 1051876890 9:21802835-21802857 CCCCGCGCCGGGGGACCGCGCCT 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1051876911 9:21802884-21802906 GTCCCTTGCCGCCGCGGGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 73
1051876891_1051876911 25 Left 1051876891 9:21802836-21802858 CCCGCGCCGGGGGACCGCGCCTC 0: 1
1: 0
2: 0
3: 49
4: 220
Right 1051876911 9:21802884-21802906 GTCCCTTGCCGCCGCGGGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 73
1051876896_1051876911 19 Left 1051876896 9:21802842-21802864 CCGGGGGACCGCGCCTCCGGGGG 0: 1
1: 0
2: 2
3: 14
4: 161
Right 1051876911 9:21802884-21802906 GTCCCTTGCCGCCGCGGGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 73
1051876902_1051876911 -4 Left 1051876902 9:21802865-21802887 CCATGCGCCCGGCCCGTGCGTCC 0: 1
1: 0
2: 2
3: 14
4: 129
Right 1051876911 9:21802884-21802906 GTCCCTTGCCGCCGCGGGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 73
1051876900_1051876911 6 Left 1051876900 9:21802855-21802877 CCTCCGGGGGCCATGCGCCCGGC 0: 1
1: 0
2: 0
3: 11
4: 170
Right 1051876911 9:21802884-21802906 GTCCCTTGCCGCCGCGGGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 73
1051876898_1051876911 11 Left 1051876898 9:21802850-21802872 CCGCGCCTCCGGGGGCCATGCGC 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1051876911 9:21802884-21802906 GTCCCTTGCCGCCGCGGGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051876911 Original CRISPR GTCCCTTGCCGCCGCGGGGA GGG Intronic
901887228 1:12231022-12231044 AGCCCTGGCCGCCTCGGGGAGGG + Intronic
903068002 1:20711542-20711564 GTCCATCGCTGCCACGGGGAGGG + Intronic
912474230 1:109925408-109925430 GTCCCTGGCCTCAGCGGGGGTGG - Intronic
915234257 1:154468947-154468969 GTCCCGTGCAGCCGTGGGCAGGG + Exonic
918480590 1:184973734-184973756 TTCCCTTCCCGCCCCGGAGAGGG - Intronic
922496512 1:226062262-226062284 GTCTCGGGCCGCGGCGGGGAGGG - Intronic
1062981353 10:1725517-1725539 GTCTCTTCCCGGCGCGGGGAGGG - Intronic
1063427713 10:5962758-5962780 CTCCTTTGCCCCCGGGGGGATGG - Intronic
1063504018 10:6580176-6580198 GCCCCGCGCCGCCGCCGGGAGGG - Intronic
1074272565 10:111969490-111969512 GTCGCTTGCAACCGCTGGGAAGG + Intergenic
1077533920 11:3110041-3110063 GTCCCATGCAGGCCCGGGGATGG - Intronic
1083751866 11:64765493-64765515 GGCCATCGCCGCCGCGGGGAGGG + Exonic
1084225086 11:67710857-67710879 GACCCTGTCCGACGCGGGGATGG + Intergenic
1087182044 11:95150881-95150903 GGCACTCGCCGCCACGGGGACGG + Intergenic
1091446581 12:547070-547092 GTCCCTTTCCCTTGCGGGGAGGG + Intronic
1096365523 12:51026029-51026051 GTCCTAGGCCGCGGCGGGGAAGG + Intronic
1096994339 12:55829599-55829621 GTCGCCGGCGGCCGCGGGGACGG - Exonic
1099133469 12:78864543-78864565 GTCCCTGTCCGCTGTGGGGATGG + Intronic
1114736595 14:25049516-25049538 GGCCCATGCCATCGCGGGGACGG + Intronic
1136588373 16:31202237-31202259 TTCCCTTCCCGCCGTGGGGCCGG + Intronic
1137627851 16:49920925-49920947 GTCCCTGGGGGCTGCGGGGAAGG - Intergenic
1139574461 16:67832404-67832426 GGCCCTGGCTGCCTCGGGGAGGG - Intronic
1140442775 16:74999739-74999761 GCGCCGTGCCGCCGCCGGGAGGG + Exonic
1141955976 16:87371552-87371574 GTCCCTGGCCACCGGGGTGATGG - Intronic
1144627802 17:16853867-16853889 GCCCCTGGCTGCGGCGGGGATGG - Intergenic
1145159396 17:20564468-20564490 GCCCCTGGCTGCAGCGGGGATGG - Intergenic
1145998029 17:29115583-29115605 GTCCCCTCCCGCCCCAGGGATGG + Intronic
1147313322 17:39607285-39607307 GTCCCTGACCGCAGAGGGGACGG - Intronic
1148467289 17:47872724-47872746 TGCCCTTGCCGCCGGGGGGCTGG - Intergenic
1151783831 17:76265630-76265652 GAGCCTGGCCGCCGCGGGGCCGG + Intronic
1152360648 17:79831766-79831788 GTCCTTTGCCACCCCGGGGGTGG - Intergenic
1153914676 18:9734815-9734837 GTGGCTTGCAGCCGCAGGGAAGG - Intronic
1159961612 18:74559528-74559550 CTCCCTTGCCACCCCCGGGAAGG - Intronic
1160869253 19:1269529-1269551 GTCCCTCGCCGCCGGCGGGGCGG - Intronic
1160961940 19:1725944-1725966 GACCTTTCCCGGCGCGGGGAGGG + Intergenic
1161702364 19:5802512-5802534 GCCCCCAGCCGCGGCGGGGAGGG + Intergenic
1165389979 19:35533324-35533346 GTCCCATGCCTCTACGGGGATGG + Intergenic
1165916717 19:39265216-39265238 GCCCCTGGCAGCCGCGGGGAGGG + Intergenic
1166306819 19:41940170-41940192 GTCCCCTTCCCCCGCGGTGACGG + Intergenic
1167292232 19:48630649-48630671 CTCCCTTGCGGGGGCGGGGAGGG - Exonic
926498598 2:13622630-13622652 GTCCCTTGCAGCAACGTGGATGG + Intergenic
930136334 2:47906504-47906526 GTCCCTCCCCGCCGCGGGGCTGG + Intergenic
931929850 2:67119534-67119556 GTCCTTTGCCGCAGCATGGAAGG + Intergenic
934655306 2:96114253-96114275 GTCCCTGGCAGGCGCTGGGATGG - Exonic
935083628 2:99823791-99823813 GTCCCTTGCGGCAACGTGGATGG + Intronic
946412634 2:219522733-219522755 CTCCCCGGCCGCCGCGGGGGCGG + Intronic
947188058 2:227472403-227472425 CTCCCTTGGCGCCGCGGCCATGG + Exonic
948224186 2:236296091-236296113 GTCCCTTGCCCCTGCTTGGAGGG + Intergenic
1168777843 20:462557-462579 GTCACGTGCCGGCGCGGGGCGGG - Intergenic
1174484234 20:50851357-50851379 GTCCCTGGGAGCCGTGGGGAGGG - Intronic
1175925128 20:62467662-62467684 GGCCCTGGCTGCCGCCGGGAGGG - Intronic
1180197508 21:46206566-46206588 GGCCCTTGCAGCCTCGGGCAAGG + Intronic
1182107648 22:27700772-27700794 GTCCCGTGCAGCAGCCGGGATGG + Intergenic
1184276191 22:43411103-43411125 GCCCCTTGCCGCGGGTGGGACGG - Intergenic
1185238435 22:49727794-49727816 TCCCCTTGGCACCGCGGGGATGG - Intergenic
960847979 3:122022191-122022213 CTCCCTCGGCGCAGCGGGGAGGG + Exonic
961654404 3:128433296-128433318 GTCACCTGGCGCCGGGGGGAGGG - Intergenic
969732450 4:8964801-8964823 GACCCTGTCCGACGCGGGGATGG - Intergenic
971231024 4:24800253-24800275 GTCCCTGGCCGCCGCCGGGTGGG - Exonic
982610964 4:157574463-157574485 GTCCCTTGCCCCCGCAGGCTCGG + Intergenic
985395856 4:189543137-189543159 GTCCTTTGCAGCAGCGTGGATGG + Intergenic
1017793897 6:157823871-157823893 GACCCTCGCCCCCGCGGGGCGGG + Intronic
1019536167 7:1530921-1530943 GGCCCGGGCCGCGGCGGGGACGG + Intronic
1021407460 7:20288945-20288967 GTCCTTTGCAGCAGCGTGGATGG + Intergenic
1021600224 7:22356988-22357010 GGCCCTGGCCGCCGCGGCGGCGG - Intronic
1022880747 7:34584700-34584722 GTTCCTGGCCGGGGCGGGGAGGG - Intergenic
1023841663 7:44101753-44101775 GTCCCTTGCTGCTGCTGGAATGG - Intergenic
1029493443 7:100884579-100884601 GTCCCTGGCAGCCTGGGGGAGGG + Intronic
1029683036 7:102125457-102125479 GTCCCTGGCCGCCGCTGGGAGGG + Intronic
1031923692 7:127619470-127619492 GTCCCCAGCTGCCCCGGGGATGG - Intergenic
1032635105 7:133698192-133698214 GTGCCTTTCCGCGGCGGGGGTGG + Intronic
1044973778 8:97644341-97644363 GGCCGCTGCCACCGCGGGGAGGG - Exonic
1051876911 9:21802884-21802906 GTCCCTTGCCGCCGCGGGGAGGG + Intronic
1053509069 9:38671939-38671961 GTCTCTAGCCCCCACGGGGAGGG - Intergenic
1061365786 9:130172095-130172117 GGCCCCCGCCGCGGCGGGGAGGG - Intergenic
1061391504 9:130319593-130319615 GTCACCTGGCGCCGCGGAGATGG + Intronic
1061712745 9:132499034-132499056 GTCCCTGCCGGCGGCGGGGAAGG - Intronic
1062362267 9:136193627-136193649 CGCCCTGGCCGCCGCGGGGAGGG - Intergenic
1189335449 X:40168354-40168376 GTCTCTTGCCTCTGCCGGGAGGG + Intronic
1196254884 X:113505470-113505492 GTCCCTTGCCGCAACATGGATGG - Intergenic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic