ID: 1051877252

View in Genome Browser
Species Human (GRCh38)
Location 9:21805688-21805710
Sequence CTCACTTAGTAGAGGGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051877252_1051877256 5 Left 1051877252 9:21805688-21805710 CCTTATTCCCTCTACTAAGTGAG No data
Right 1051877256 9:21805716-21805738 ACCATCTATGAGCCAAAACGTGG No data
1051877252_1051877258 6 Left 1051877252 9:21805688-21805710 CCTTATTCCCTCTACTAAGTGAG No data
Right 1051877258 9:21805717-21805739 CCATCTATGAGCCAAAACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051877252 Original CRISPR CTCACTTAGTAGAGGGAATA AGG (reversed) Intronic
No off target data available for this crispr