ID: 1051877252

View in Genome Browser
Species Human (GRCh38)
Location 9:21805688-21805710
Sequence CTCACTTAGTAGAGGGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051877252_1051877256 5 Left 1051877252 9:21805688-21805710 CCTTATTCCCTCTACTAAGTGAG 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1051877256 9:21805716-21805738 ACCATCTATGAGCCAAAACGTGG No data
1051877252_1051877258 6 Left 1051877252 9:21805688-21805710 CCTTATTCCCTCTACTAAGTGAG 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1051877258 9:21805717-21805739 CCATCTATGAGCCAAAACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051877252 Original CRISPR CTCACTTAGTAGAGGGAATA AGG (reversed) Intronic
902726092 1:18337160-18337182 CTCACCTAGTGGATGGAGTAAGG - Intronic
907394437 1:54179401-54179423 GTCCCATAGTAGAGGGGATAAGG - Intronic
908549575 1:65195157-65195179 CTCACACAAGAGAGGGAATAAGG + Intronic
908988638 1:70057198-70057220 CTCTCAGAGTAGAGAGAATAAGG + Intronic
909344917 1:74573331-74573353 CTGACATAGTACAGGGAAAAGGG - Exonic
909852133 1:80480970-80480992 CTCACTTTTTAGAAGGAAAAGGG + Intergenic
910728377 1:90362491-90362513 CTCCCAGAGTAGATGGAATATGG + Intergenic
914977690 1:152380889-152380911 CTCACTTAGAAAAGGAAAAAGGG + Intergenic
916351963 1:163860684-163860706 CTCACTTAGCAGAAAAAATAAGG + Intergenic
918166328 1:181952058-181952080 CTCATTTCTTACAGGGAATAGGG + Intergenic
918878853 1:190086944-190086966 ATTACTTAGTATAGGGAATAAGG + Intergenic
919401338 1:197121168-197121190 ATTAGTTAGTAGATGGAATAGGG + Intronic
920831790 1:209472133-209472155 CTCACATGGTAGAGGGAATAAGG + Intergenic
922965476 1:229687489-229687511 CTCACTGAGGAAAGGAAATAGGG - Intergenic
1071318046 10:84422132-84422154 CTCACTTTGCAGAAGGAAGAAGG + Intronic
1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG + Exonic
1074893065 10:117751325-117751347 CTAACATAGTACAGGGAAGATGG - Intergenic
1076532457 10:131154129-131154151 GACAGTTAGAAGAGGGAATATGG - Intronic
1078149863 11:8749306-8749328 CTCACTCAGTACAGGGAAGCTGG + Intronic
1078329000 11:10403271-10403293 CTCACATAGTCCAGGGAAAAGGG + Intronic
1084783953 11:71430774-71430796 CTCATTCAGTAGAGGGGAGACGG - Intronic
1085699002 11:78729685-78729707 CTCACCGAGTGGAGGGAAGATGG + Intronic
1088367943 11:109058580-109058602 CTCACCAAGTAGAGGGAGCAGGG - Intergenic
1092203789 12:6603446-6603468 CCCACTGAGGAGAGGGAAAATGG + Intronic
1092565881 12:9664991-9665013 CTCACATAGTAGAAGGAACAAGG - Intronic
1092669238 12:10843629-10843651 TTTTCTTAGTAGAAGGAATAGGG + Intronic
1098558337 12:71844458-71844480 TTTAATTAGTAGAGGGTATAGGG - Intronic
1099805706 12:87516413-87516435 CTCACTTACAAGTGAGAATATGG - Intergenic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1104223567 12:126810041-126810063 CTCACTGAGAAGATGGAATTTGG + Intergenic
1105250589 13:18695880-18695902 CCTACTTAGTAGAGGGAGTGAGG + Intergenic
1106186715 13:27416078-27416100 CTCACTTAGTAGATGGAGTCTGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1109707901 13:66122813-66122835 CTCACTTATAAGAGGGAACATGG + Intergenic
1110323751 13:74189517-74189539 CACAGTTAGCAGAGGGAACAAGG - Intergenic
1111100921 13:83585050-83585072 CACATTTAGTAGAGTGAAAAGGG + Intergenic
1111562437 13:89968569-89968591 CTCACCTAGTAGAGTGATAAAGG - Intergenic
1112646757 13:101341918-101341940 CTCACGTAGTAGAAGCAGTAAGG - Intronic
1112884032 13:104147014-104147036 CTCACATGGTAGAAGGAAGAAGG + Intergenic
1114731291 14:24995191-24995213 CTCACATGGTAGAAGGAACAAGG + Intronic
1116968961 14:51044841-51044863 CTCACTTAGTGGAGATGATAGGG - Intronic
1118581172 14:67299775-67299797 CTGACTTAAAAGTGGGAATAGGG + Intronic
1119139033 14:72248188-72248210 CACACTTAGGAGAGAGAAAAAGG - Intronic
1119470107 14:74891276-74891298 TGCCCTTAGTTGAGGGAATAAGG + Intronic
1119745459 14:77040644-77040666 CTCACTGACTAGAGGGAGGAGGG - Intergenic
1122572642 14:102717655-102717677 CTCACTCAGCAGAGGGAGAAAGG - Intronic
1123877754 15:24640867-24640889 TTCAATTTGTGGAGGGAATATGG - Intergenic
1127487878 15:59436385-59436407 CTCAAGTAGTAGAGGGAGTAGGG + Intronic
1131539954 15:93267663-93267685 CTCACATGGTAGAGGGAACAAGG + Intergenic
1135785425 16:25344663-25344685 TTTACTTAGCAGAGAGAATAGGG + Intergenic
1138765331 16:59595444-59595466 CTCTCTTAGTAGAGGAGAAATGG + Intergenic
1140559657 16:75963810-75963832 GTCACTTAGTAGAGTGGTTATGG + Intergenic
1148534118 17:48424182-48424204 CTCACATAGTGGAAGGAGTAAGG + Intronic
1149010840 17:51854670-51854692 CTCTCCTAGAAGAGGGTATATGG + Intronic
1153487089 18:5610201-5610223 CTCACTTGGAACATGGAATATGG - Intronic
1154438259 18:14363046-14363068 CCTACTTAGTAGAGGGAGTGAGG - Intergenic
1156267754 18:35503749-35503771 CACACTGAGCAGAGTGAATAGGG - Intergenic
1162656713 19:12136842-12136864 CTCACTTACCAGAAGGAACAGGG + Intronic
925352455 2:3210937-3210959 CTCACTTAGTAGTGGGAGCTAGG - Intronic
925784045 2:7411179-7411201 CTCATTTATTAGAGGAAATATGG - Intergenic
926435438 2:12833100-12833122 CTCACTTTGTAGAGGAGAAAAGG - Intergenic
927723464 2:25402918-25402940 CTTTCTTAGTAGAAGGAAGAAGG + Intronic
927945280 2:27131815-27131837 CTCACGTAGTAGAGGCACTGTGG + Exonic
928044108 2:27910153-27910175 CTCCCTTAGTAGAGGAGACAAGG + Intronic
930894940 2:56435080-56435102 CTGACTTTGTAGAATGAATATGG + Intergenic
931935994 2:67196901-67196923 CTCACTTAGTAACTGGAAGATGG + Intergenic
936311441 2:111388376-111388398 CTCACATGGTAGAGGGGATGAGG - Intergenic
936896374 2:117432513-117432535 CTCAGATAGTGGAAGGAATAAGG + Intergenic
937129425 2:119496496-119496518 TGCACTTAGTAGACGTAATAGGG - Intronic
937306600 2:120875401-120875423 CTCACTTGGAGGAGGGTATATGG + Intronic
939880415 2:147624535-147624557 CTCTCTTAGAAGAGTCAATAAGG - Intergenic
942014871 2:171802881-171802903 CTCACTTACTACAGGAAAGAGGG - Intronic
945005755 2:205403946-205403968 CTCACTCAATTAAGGGAATATGG + Intronic
946907406 2:224430047-224430069 CTCAGTTGGTAGAGGGGAGATGG + Intergenic
1169635794 20:7690038-7690060 CTCACATGGTAGAAGGAAAAAGG - Intergenic
1177150579 21:17451486-17451508 GTCACTTAGGAGAGTGAGTAAGG + Intergenic
1182994349 22:34799070-34799092 CTCACTTAGTAGAAGGTCAAGGG - Intergenic
950875336 3:16266157-16266179 CTTTCTTAGAAGAGGAAATAAGG - Intronic
951271732 3:20633295-20633317 CTAAGTAAGTAAAGGGAATATGG - Intergenic
952760460 3:36908997-36909019 CTCTCTTAGCAGATGGAACAGGG + Intronic
956028657 3:65012043-65012065 CTCACTAAGTAGAGGAGACAGGG + Intergenic
958875235 3:99608945-99608967 CTCCCTTAGTAAAGGGAATCTGG + Intergenic
965211436 3:165794547-165794569 CTCACATAGTAGAAGGGAGAAGG + Intronic
965867514 3:173223167-173223189 CTAACTCAGTAGAAGGAATGAGG + Intergenic
970113736 4:12669452-12669474 CCCACTTATAAGTGGGAATATGG - Intergenic
974855757 4:67458963-67458985 TGTACTTAGTGGAGGGAATAGGG - Intergenic
975485316 4:74928843-74928865 CTCAGTTAGTAGATGGCAGAGGG + Intergenic
978771711 4:112463786-112463808 CTCACTTAGGAGTGAGAATATGG - Intergenic
980493044 4:133554204-133554226 CTAACTTTGTAGAAGGGATATGG + Intergenic
981051651 4:140315122-140315144 CTCACTGAAGAGAGAGAATATGG - Intronic
983910605 4:173234742-173234764 CTCACTTATTACAGTGAAGATGG - Intronic
986124661 5:4874141-4874163 CTCACCTTGTGGAGGGGATAAGG + Intergenic
986164764 5:5264050-5264072 CTCAGTTGGTAGAGGGGAGATGG - Intronic
987188209 5:15446279-15446301 CTCACTGACAACAGGGAATAAGG + Intergenic
987758102 5:22123207-22123229 CTCACATAGCAGAAGGAATGAGG - Intronic
988118057 5:26921751-26921773 CTCACTTGGAAGAAGGAATTCGG - Intronic
988699077 5:33655088-33655110 CATACTTAGTAGACGGCATATGG + Intronic
989664493 5:43838022-43838044 CTCACTTTGCAGAGGGCACAAGG - Intergenic
990209083 5:53462689-53462711 TTCACTTTATAGAGGGACTAGGG + Intergenic
990755597 5:59066061-59066083 TTCTTTTAGTAGAAGGAATAAGG - Intronic
990988796 5:61664999-61665021 CTTAGATTGTAGAGGGAATACGG - Intronic
994769129 5:103958836-103958858 CTCACTGAGTTGAGGAAATGGGG + Intergenic
995999051 5:118336020-118336042 CTCACTTTGGAGAGTGAATTAGG - Intergenic
996016391 5:118538611-118538633 CTCACTTTGCAGATGGAAGACGG - Intergenic
998173073 5:139883650-139883672 CTCACCTAGTAGAGGGGCCAGGG - Intronic
1001153716 5:169254614-169254636 CTAGCTTAGAAGAGGCAATAGGG + Intronic
1001973706 5:175979206-175979228 CTCAGTCAGTAGAGGGGAGATGG + Intronic
1002243726 5:177864573-177864595 CTCAGTCAGTAGAGGGGAGATGG - Intergenic
1002492492 5:179588664-179588686 GTCACTTAGTAAAGGGGTTATGG - Intronic
1003634745 6:7821961-7821983 TTCACTGGGTAGAGGGAATGTGG - Intronic
1006910156 6:37558429-37558451 CTCACTAAGAAGAGGGAGCATGG + Intergenic
1009406530 6:63320619-63320641 CTAACTCAGTAGAGGAAATAGGG + Intergenic
1009764605 6:68055790-68055812 CTACCTTAGAAGAGGCAATAAGG - Intergenic
1014135712 6:117886538-117886560 CTCAATTAGTAGTGGAAACATGG - Intergenic
1014471539 6:121821292-121821314 CCTACTTAGTAGAGGGGAAAAGG - Intergenic
1015010105 6:128335494-128335516 CTCAAGTAGTAGAAGGAAAAAGG + Intronic
1015195830 6:130523978-130524000 CTCACGTAGCAGAGGGAGTATGG - Intergenic
1019207210 6:170371951-170371973 CTCACTTAACACAGGGAAAACGG - Intronic
1022232306 7:28426096-28426118 CTCAGTTAATAGGGGGAATCGGG - Intronic
1023044551 7:36199624-36199646 CTCAGTCAGAAGAGGGAAAAGGG - Intronic
1024417715 7:49126870-49126892 TTAACTTTGTAGAGGGAATCTGG - Intergenic
1024487582 7:49936215-49936237 GTCACTTACTAGAGGAAAGAAGG + Intronic
1030787881 7:113684792-113684814 CTCAGTCAGTAGAGGGGAGATGG - Intergenic
1030896310 7:115065195-115065217 CTCACTTAGGAGTGGAGATAGGG - Intergenic
1040788480 8:51195776-51195798 CTCACTAAGATGAGGAAATATGG + Intergenic
1041564916 8:59265805-59265827 TTCTCTTATTAGAGGGAAAAAGG - Intergenic
1043642019 8:82465741-82465763 TTAGCTTAGTAGAGGAAATAAGG + Intergenic
1044522077 8:93210387-93210409 CTCACTTGGTAGACAGAAAATGG - Intergenic
1045318660 8:101064761-101064783 CTCACTTAGAAGAAGGGGTATGG + Intergenic
1046265775 8:111827841-111827863 CTCACTTAGTGAAGGAAATAAGG - Intergenic
1049992196 9:1000537-1000559 CTCAGTGAGTAGAAGGGATAGGG + Intergenic
1051877252 9:21805688-21805710 CTCACTTAGTAGAGGGAATAAGG - Intronic
1052214916 9:25954255-25954277 CTGACTTAGTAGAGTCAATAGGG + Intergenic
1052578080 9:30316401-30316423 ATTAATTAGTAGAGGGAACATGG - Intergenic
1057561480 9:96131286-96131308 CTCACTGAGAAGAGGGATCAGGG + Intergenic
1186146222 X:6626964-6626986 CTCACATAGTAGAAGGGGTAAGG + Intergenic
1187160093 X:16756651-16756673 CTCACTTCTTAGAGGCAGTACGG + Exonic
1187927029 X:24260114-24260136 CTCACATAGTAGAGGGCAGAGGG + Intergenic
1188153782 X:26715410-26715432 TTAAATTAGTAGAGGGACTAGGG - Intergenic
1188967446 X:36572285-36572307 ATCACCTATTAGAGGTAATAGGG + Intergenic
1193679312 X:84498782-84498804 CTAACTTTGTAGAAGTAATATGG + Intronic
1198097680 X:133396699-133396721 TTGACTTATTGGAGGGAATATGG + Intronic
1201625810 Y:16013060-16013082 GAGACTTAGTAGAGGTAATAGGG + Intergenic
1201929220 Y:19322853-19322875 CTCACTTAGATAAGAGAATAAGG + Intergenic