ID: 1051877567

View in Genome Browser
Species Human (GRCh38)
Location 9:21807714-21807736
Sequence CTGCTCAGCAGAGTAAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051877559_1051877567 27 Left 1051877559 9:21807664-21807686 CCCAAAAAAGACTACCTGCTGAA 0: 1
1: 0
2: 2
3: 14
4: 221
Right 1051877567 9:21807714-21807736 CTGCTCAGCAGAGTAAAAGGAGG No data
1051877560_1051877567 26 Left 1051877560 9:21807665-21807687 CCAAAAAAGACTACCTGCTGAAG 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1051877567 9:21807714-21807736 CTGCTCAGCAGAGTAAAAGGAGG No data
1051877563_1051877567 13 Left 1051877563 9:21807678-21807700 CCTGCTGAAGAGAGGTAGGAGCA 0: 1
1: 0
2: 0
3: 8
4: 180
Right 1051877567 9:21807714-21807736 CTGCTCAGCAGAGTAAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051877567 Original CRISPR CTGCTCAGCAGAGTAAAAGG AGG Intronic
No off target data available for this crispr