ID: 1051880078

View in Genome Browser
Species Human (GRCh38)
Location 9:21831036-21831058
Sequence CCTCCTGTACTTGTGGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051880072_1051880078 21 Left 1051880072 9:21830992-21831014 CCCTGCCAGCTGCTTTATTCAAG 0: 1
1: 0
2: 0
3: 12
4: 198
Right 1051880078 9:21831036-21831058 CCTCCTGTACTTGTGGTACATGG No data
1051880074_1051880078 16 Left 1051880074 9:21830997-21831019 CCAGCTGCTTTATTCAAGTCATG 0: 1
1: 0
2: 1
3: 21
4: 159
Right 1051880078 9:21831036-21831058 CCTCCTGTACTTGTGGTACATGG No data
1051880073_1051880078 20 Left 1051880073 9:21830993-21831015 CCTGCCAGCTGCTTTATTCAAGT 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1051880078 9:21831036-21831058 CCTCCTGTACTTGTGGTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051880078 Original CRISPR CCTCCTGTACTTGTGGTACA TGG Intronic
No off target data available for this crispr