ID: 1051880823

View in Genome Browser
Species Human (GRCh38)
Location 9:21838036-21838058
Sequence CAAGCCCACATGATTTATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051880823_1051880831 17 Left 1051880823 9:21838036-21838058 CCAGAATAAATCATGTGGGCTTG 0: 1
1: 0
2: 0
3: 4
4: 145
Right 1051880831 9:21838076-21838098 TGGTTAATTGGCAGAGCGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 91
1051880823_1051880829 -3 Left 1051880823 9:21838036-21838058 CCAGAATAAATCATGTGGGCTTG 0: 1
1: 0
2: 0
3: 4
4: 145
Right 1051880829 9:21838056-21838078 TTGGGGTGGCATCTGGCATTTGG 0: 1
1: 0
2: 0
3: 15
4: 187
1051880823_1051880830 5 Left 1051880823 9:21838036-21838058 CCAGAATAAATCATGTGGGCTTG 0: 1
1: 0
2: 0
3: 4
4: 145
Right 1051880830 9:21838064-21838086 GCATCTGGCATTTGGTTAATTGG 0: 1
1: 0
2: 1
3: 10
4: 134
1051880823_1051880828 -10 Left 1051880823 9:21838036-21838058 CCAGAATAAATCATGTGGGCTTG 0: 1
1: 0
2: 0
3: 4
4: 145
Right 1051880828 9:21838049-21838071 TGTGGGCTTGGGGTGGCATCTGG 0: 1
1: 0
2: 2
3: 23
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051880823 Original CRISPR CAAGCCCACATGATTTATTC TGG (reversed) Intronic
904382626 1:30121694-30121716 CAAGTCCCCTTGATTTATTTGGG - Intergenic
906549584 1:46652342-46652364 CAAACCCACATGATTTCATAAGG + Intronic
906593165 1:47047343-47047365 CAAGCCAACAGGATTGCTTCTGG + Intronic
910497288 1:87845302-87845324 CAAGCCCAGATGTTTTAATTGGG + Intergenic
912731936 1:112114850-112114872 CTAGGCCACATGATATAGTCTGG - Intergenic
915381032 1:155440962-155440984 TCAGGCCACATCATTTATTCTGG + Intronic
915393625 1:155565138-155565160 CATGCCCACCTGATTTTTTTTGG - Intergenic
917530934 1:175834328-175834350 CAGGCCCAGCTGATTTATTTTGG - Intergenic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
920711936 1:208303434-208303456 GAAGCCCACAGGCTTTATCCAGG + Intergenic
923044692 1:230347165-230347187 CTGGCCCACCTGGTTTATTCAGG - Intronic
923870622 1:237989695-237989717 CAAGCACAACTGATTTATTTGGG - Intergenic
924642479 1:245847537-245847559 CAGGCCCACCTGATTTCTTTTGG + Intronic
1063762130 10:9091585-9091607 CAGTCCCACATAATGTATTCTGG - Intergenic
1063976240 10:11418095-11418117 CAAGCACACATGATAAAATCAGG - Intergenic
1065150344 10:22816500-22816522 CATGGCCACGTGATTTACTCTGG + Intergenic
1068086204 10:52375788-52375810 TAAGAACACATTATTTATTCAGG + Intergenic
1070668303 10:78360874-78360896 GAAGCCCAGCTGATTTAATCAGG + Intergenic
1071131202 10:82395511-82395533 TAAGTCCATATTATTTATTCTGG - Intronic
1076125232 10:127969010-127969032 CAAGCCTAAATGATTCAGTCAGG + Intronic
1077066497 11:643346-643368 CAGGACCACCTGGTTTATTCCGG - Intergenic
1077620487 11:3717917-3717939 CATGGCCAAAAGATTTATTCTGG - Intronic
1088835191 11:113572168-113572190 CAAGTCCACATTTTTTATTACGG + Intergenic
1094079946 12:26523090-26523112 CAAGCTCACATCATTGATTTTGG + Intronic
1094395537 12:30001413-30001435 CAAGCCCTCTTATTTTATTCAGG - Intergenic
1097961441 12:65535358-65535380 CAAGCGCACATGAGCTGTTCTGG + Intergenic
1098766286 12:74494413-74494435 CAATCCCTCATGACTTATTATGG + Intergenic
1106176731 13:27338147-27338169 TAAGCCCACATGATTGGTCCTGG + Intergenic
1106578157 13:30995025-30995047 AAAGCCCTCATGATATTTTCAGG - Intergenic
1107064879 13:36202471-36202493 CTCTCCCACATGATTTATTTTGG + Intronic
1107855095 13:44607282-44607304 CAGTCCCACAAGATTTATCCAGG + Intergenic
1109523981 13:63551521-63551543 CAAGCCCATTTTATTTATTAAGG + Intergenic
1111269331 13:85860417-85860439 CAAGCTGAAATGATTTATTTTGG - Intergenic
1113380777 13:109803773-109803795 CATTCCTACATGATTTATTGAGG - Intergenic
1114181473 14:20371696-20371718 CAATCCCACATGAATTCCTCAGG + Intronic
1116334809 14:43643778-43643800 CAACCCCACAAGATTAAATCAGG + Intergenic
1117608426 14:57456347-57456369 CAGGACCACATGATTGAGTCTGG - Intergenic
1118534211 14:66741437-66741459 CATGCATATATGATTTATTCAGG + Intronic
1118977502 14:70690390-70690412 CAAGCCCGCATCACTCATTCGGG + Intergenic
1119082787 14:71711686-71711708 CAAACCCAGATGCTTTTTTCAGG - Intronic
1119847979 14:77845054-77845076 CAAGCTGAGATGATTTGTTCAGG + Intronic
1122289530 14:100672749-100672771 CAAGGGCACATGGTTTATTTGGG - Intergenic
1123709702 15:22978809-22978831 CAAGCCCACATGTGACATTCTGG + Intronic
1125785634 15:42314807-42314829 TAAGGCCACAATATTTATTCTGG - Intronic
1125908506 15:43415445-43415467 CAAGCCCACAGGTGATATTCAGG - Intronic
1127243257 15:57142244-57142266 CAACACCACAGGATTCATTCTGG - Intronic
1128280738 15:66392162-66392184 CATGGCCACATGATTTGCTCTGG - Intronic
1130385694 15:83409625-83409647 CAACACTACAAGATTTATTCTGG + Intergenic
1133523430 16:6580885-6580907 CAAGCCCAAATGAGATATGCAGG - Intronic
1133993051 16:10725811-10725833 CACGCCTGCATGACTTATTCAGG - Intergenic
1135842224 16:25887240-25887262 CAAGGCTATATCATTTATTCAGG + Intronic
1138034141 16:53585870-53585892 CAGGCCCAGATGATTTTTTAGGG - Intergenic
1139522741 16:67494112-67494134 CAGGCCCACATAATTCTTTCTGG + Intergenic
1139551656 16:67676478-67676500 CTAGCCCACCTGTGTTATTCAGG - Intronic
1140604980 16:76524922-76524944 CAAGCTGACATGATTTAGTGTGG + Intronic
1141603140 16:85138190-85138212 CAAAACCACATCATTTGTTCAGG - Intergenic
1151447149 17:74174645-74174667 CACGCCCAGATGATTTTTTTTGG - Intergenic
1155318285 18:24593847-24593869 CAAGCCCACCTGCTTTATCTTGG + Intergenic
1155837735 18:30608096-30608118 CATGCCCACATGGCTTATGCAGG + Intergenic
1155880474 18:31141875-31141897 CAAGGCCAAATGATTTATATTGG - Intronic
1158936328 18:62368167-62368189 CAACTCAACATGATTCATTCTGG + Intronic
1159107908 18:64025256-64025278 CAAACCAACATGGTTTACTCTGG + Intergenic
1160490069 18:79329525-79329547 AAATCCCACATTATTGATTCTGG - Intronic
927418771 2:22907454-22907476 GAAGCGCACATGTTTTCTTCTGG - Intergenic
927843801 2:26461218-26461240 CCAGCCCCCATGCTTTACTCAGG + Intronic
929242949 2:39671037-39671059 CAAACCCAGTTGATTTATACAGG - Intronic
933737499 2:85506996-85507018 CAAGCTCACATGATTTCATTTGG - Intergenic
936654230 2:114466125-114466147 AAATCCCATATGATTTATTATGG + Intronic
940864755 2:158806980-158807002 AAAGGCCACATGATTTATAGAGG - Intronic
943665672 2:190606003-190606025 CAACCCAACAACATTTATTCAGG - Intergenic
943991473 2:194698689-194698711 GCAGCACATATGATTTATTCAGG - Intergenic
945604609 2:211912979-211913001 CACGGCCAAATGATTTATGCTGG - Intronic
1169167791 20:3439382-3439404 CAATACCACATTATTTATTTTGG - Intergenic
1173381934 20:42553091-42553113 CAAGTTCACATGATTCTTTCAGG - Intronic
1174917752 20:54671049-54671071 CAAGCCGACAAGATTTCTCCAGG + Intergenic
1177277842 21:18938417-18938439 CCAGGCCCCATGATTAATTCAGG - Intergenic
1178173466 21:30069574-30069596 AAAGCCCACATGAATTAGACGGG + Intergenic
1179292705 21:40032514-40032536 CAATCTCACATTATTTATTTAGG + Intronic
1182667329 22:31969380-31969402 CAAGCCCACCTAAATTATCCAGG + Intergenic
949189186 3:1231128-1231150 CAAGTGCATATGATTTATTGAGG - Intronic
950714626 3:14838932-14838954 CAAGTCCACCTGTTATATTCTGG + Intronic
950739495 3:15038868-15038890 CAGCCCCACATGATTGGTTCTGG - Intronic
951100776 3:18685228-18685250 CAAGTCCAAATAATTTATTAGGG - Intergenic
951638998 3:24813142-24813164 CAACTCCAGATGTTTTATTCTGG - Intergenic
951643607 3:24863312-24863334 CAAGCTCACATGAATTCCTCTGG - Intergenic
951953995 3:28233734-28233756 CAATCCCACATCACTGATTCTGG - Intergenic
954939319 3:54356550-54356572 CCAGCCCACATTATTTATAAAGG - Intronic
955974209 3:64464920-64464942 CAAGCCCACCTTATCCATTCTGG + Intergenic
959779458 3:110211352-110211374 CTAGCTCTCATGATTTATTCTGG - Intergenic
960165879 3:114400761-114400783 CCAGCCCACATGATTTCACCTGG + Intronic
960635156 3:119777766-119777788 CCAGCCAACATTTTTTATTCTGG - Intergenic
960843264 3:121981857-121981879 TAAGCCCTCCTGATATATTCTGG + Intergenic
962610912 3:137075501-137075523 AATGCACAAATGATTTATTCAGG - Intergenic
963140933 3:141945623-141945645 CAAGCCCAGAGGAGCTATTCAGG + Intergenic
963348451 3:144124477-144124499 CAGCCCCACACAATTTATTCTGG + Intergenic
963356728 3:144217473-144217495 CAACCCCATCTGATTTATTTAGG - Intergenic
963371128 3:144401838-144401860 CAAGCCTAGAAGTTTTATTCAGG + Intergenic
963372360 3:144417171-144417193 CAGGACCACATGACTTGTTCTGG - Intergenic
964338538 3:155683919-155683941 CAAGCACTTAGGATTTATTCTGG - Intronic
967535027 3:190592274-190592296 GAAGCCCACATAATGAATTCTGG - Intronic
975244436 4:72103152-72103174 CAAACACAAATGATTTATTAAGG + Intronic
975464118 4:74689983-74690005 CAAGCCCAGCTAATTTATTTTGG + Intergenic
975950049 4:79759456-79759478 AAACCCCACATAATTAATTCAGG - Intergenic
978419110 4:108511293-108511315 CATGCCCACCTGATTCCTTCTGG - Intergenic
980120526 4:128723612-128723634 AAAGGTCACATGACTTATTCTGG - Intergenic
980454814 4:133025461-133025483 CAATCCCCCAAGATTGATTCAGG + Intergenic
981602099 4:146501420-146501442 TAAGGCCATATGACTTATTCTGG + Intronic
982936335 4:161481892-161481914 CAAGCCCTTGTGATTTATCCTGG + Intronic
983082788 4:163408276-163408298 CATGACTACATGCTTTATTCAGG + Intergenic
988704747 5:33714003-33714025 CAAGCCCACATGAAGATTTCAGG - Intronic
989476155 5:41875552-41875574 TAAGGCCACATGATTTGTTGAGG - Intergenic
994813540 5:104555049-104555071 CAAACACAGATGATTTATTTTGG + Intergenic
997948823 5:138225545-138225567 CAAGCCCAGATAATTTTTTGAGG + Intergenic
999907267 5:156155632-156155654 GAAGCACACAGGATTTACTCTGG + Intronic
1000533376 5:162451521-162451543 CAATCCCATATAATTAATTCTGG - Intergenic
1002780892 6:365134-365156 CAAGCCCACAATATTTTTGCTGG - Intergenic
1003999553 6:11584279-11584301 CAAGACCACATAATTTCATCTGG - Intergenic
1004280502 6:14275948-14275970 CAAGCACAAATCATTTATTTAGG + Intergenic
1006616112 6:35328205-35328227 GAAGCACACATAATTGATTCAGG - Intergenic
1008713272 6:54255920-54255942 CAAACCCAAGTGATTTATCCTGG - Intronic
1013753800 6:113437536-113437558 CTAGTCCACATGGTTTATTGTGG - Intergenic
1014732760 6:125053023-125053045 CAAGAGCACATGATATATTGGGG - Intronic
1016494680 6:144647233-144647255 AAAGCCCATAGGATTTATACTGG + Intronic
1019923797 7:4179509-4179531 CAAGCCCAGCGGATTTTTTCCGG + Intronic
1020069616 7:5217775-5217797 CAAACCCACTTGATTTACTGGGG - Intronic
1020406567 7:7841873-7841895 CAAGCTGACATGAATTATTATGG - Intronic
1022276827 7:28863371-28863393 CTAACCCACAAAATTTATTCAGG - Intergenic
1023106897 7:36771491-36771513 CATGCCCACCTGATTAAGTCTGG - Intergenic
1023904130 7:44509390-44509412 CAAGGACACATGATTTATGATGG - Intergenic
1030012539 7:105184812-105184834 AAAGACCACATGACTTATTAGGG - Intronic
1030124335 7:106140274-106140296 AAAACCCAAAGGATTTATTCTGG - Intergenic
1031671789 7:124556396-124556418 CAAACCCTCATTATTTATCCTGG - Intergenic
1031675651 7:124609173-124609195 CAAGTCCACATGCATTTTTCAGG + Intergenic
1033092532 7:138399457-138399479 CCAGCCCACATGAATTTTGCAGG + Intergenic
1037459320 8:19093545-19093567 CAAGCCCAGTTCATTTCTTCAGG + Intergenic
1040458229 8:47621376-47621398 CATGCCCAGATGATTCATTTGGG - Intronic
1042214280 8:66413974-66413996 CAAGTCCACATGATTAGTTCTGG + Intergenic
1051880823 9:21838036-21838058 CAAGCCCACATGATTTATTCTGG - Intronic
1059785402 9:117577316-117577338 GAAGCCCTCATGACTTAATCAGG - Intergenic
1061116326 9:128615152-128615174 CAGGCTCACTTTATTTATTCTGG + Intronic
1186170190 X:6868669-6868691 AAAGCCTACTTTATTTATTCTGG + Intergenic
1186460095 X:9741337-9741359 CAAGACCACATGGTTTATTATGG - Exonic
1188049885 X:25471963-25471985 CAGGACCATATGATTAATTCTGG - Intergenic
1188255629 X:27959424-27959446 GAAGCCCAAACGTTTTATTCTGG + Intergenic
1189158706 X:38787828-38787850 GAAGTCCACCTGATTTATTCTGG - Intergenic
1189911869 X:45818120-45818142 CATGCCCACCTGATTTTTTTAGG - Intergenic
1190031502 X:46977682-46977704 CAAATGCACATGATTTATTGAGG + Intronic
1195557576 X:106244398-106244420 CAAGCCCACATATGTTTTTCTGG + Intergenic
1197462266 X:126757098-126757120 CAAGTCCACCTCATTTGTTCAGG + Intergenic
1198657166 X:138927042-138927064 AAAGCCAAGATGATTTATTTAGG + Intronic