ID: 1051889131

View in Genome Browser
Species Human (GRCh38)
Location 9:21925214-21925236
Sequence AAAGTGGTGGGGTTTCCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051889131_1051889137 -3 Left 1051889131 9:21925214-21925236 CCTCTTGGAAACCCCACCACTTT No data
Right 1051889137 9:21925234-21925256 TTTCCTAGAGAGGCTACAAGAGG No data
1051889131_1051889139 3 Left 1051889131 9:21925214-21925236 CCTCTTGGAAACCCCACCACTTT No data
Right 1051889139 9:21925240-21925262 AGAGAGGCTACAAGAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051889131 Original CRISPR AAAGTGGTGGGGTTTCCAAG AGG (reversed) Intronic