ID: 1051889895

View in Genome Browser
Species Human (GRCh38)
Location 9:21930881-21930903
Sequence CTGGAAATGGGATCTTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 207}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051889885_1051889895 26 Left 1051889885 9:21930832-21930854 CCAGCTTACAAGAACAAGCCTCT 0: 1
1: 0
2: 1
3: 7
4: 126
Right 1051889895 9:21930881-21930903 CTGGAAATGGGATCTTCCCTGGG 0: 1
1: 0
2: 1
3: 19
4: 207
1051889884_1051889895 29 Left 1051889884 9:21930829-21930851 CCTCCAGCTTACAAGAACAAGCC 0: 1
1: 0
2: 1
3: 6
4: 108
Right 1051889895 9:21930881-21930903 CTGGAAATGGGATCTTCCCTGGG 0: 1
1: 0
2: 1
3: 19
4: 207
1051889887_1051889895 8 Left 1051889887 9:21930850-21930872 CCTCTCGTGGTTAGTTAGATTGG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1051889895 9:21930881-21930903 CTGGAAATGGGATCTTCCCTGGG 0: 1
1: 0
2: 1
3: 19
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051889895 Original CRISPR CTGGAAATGGGATCTTCCCT GGG Intronic
902734147 1:18389084-18389106 CTGGAGCTGGGATCTGCACTTGG + Intergenic
903544864 1:24117749-24117771 CTGGAAATGGGATCGGACCCAGG + Intergenic
904834946 1:33329775-33329797 ACGGAAATGGGGTCTCCCCTGGG - Intronic
910183192 1:84506809-84506831 CTGGAGAAGGGATCTTCTCGAGG + Intergenic
910464980 1:87489229-87489251 CTTGAAATGGGAACTACCCCTGG - Intergenic
910634718 1:89394732-89394754 CTGCAAATGGGATCAGCACTGGG - Intergenic
910646191 1:89517882-89517904 CTGGACATGGGGTCTTCTCTTGG - Intergenic
911263188 1:95711491-95711513 CTAGAATTTGGCTCTTCCCTGGG - Intergenic
911266044 1:95744165-95744187 CTGGAAAGGTTATCTTCACTTGG - Intergenic
919400912 1:197115179-197115201 CTTGAAATGGGATCTACTCCTGG - Intronic
921714950 1:218408243-218408265 CTGGAGATGGGATGGGCCCTGGG - Intronic
923772189 1:236947338-236947360 CTGGGAATGAGGTCTTTCCTGGG + Intergenic
924559415 1:245145157-245145179 TTGTAAATGGGATCTTCATTGGG - Intergenic
1063523397 10:6761096-6761118 GTGGGAAGGTGATCTTCCCTTGG - Intergenic
1063950157 10:11214551-11214573 CTGGAGATGGGATCCCCTCTTGG + Intronic
1064651777 10:17516835-17516857 CTGGAAATTGCATCTTGGCTAGG - Intergenic
1064753101 10:18552296-18552318 CTGGAAATGGATACTTCTCTTGG + Intronic
1065216954 10:23458468-23458490 CTGGCAATTGGCTCTTCCCCTGG - Intergenic
1065551958 10:26876965-26876987 CTGAGAATGGGATCTTTCCCAGG + Intergenic
1066021940 10:31312543-31312565 CAGGAAATGGAGTCTCCCCTAGG + Intergenic
1067761038 10:49047337-49047359 CTGAAGCTGGGACCTTCCCTGGG + Intronic
1069126594 10:64642966-64642988 CTTGAAATGGAATCTACCCCTGG + Intergenic
1069255226 10:66323965-66323987 GTGGAAAGATGATCTTCCCTTGG - Intronic
1070396484 10:76015334-76015356 CTTGGAAAGGGATCCTCCCTGGG - Intronic
1070855258 10:79603444-79603466 GTGGGAAGGTGATCTTCCCTTGG + Intergenic
1071111181 10:82158860-82158882 CTGGAAATGAAATCTTTCATGGG + Intronic
1073831466 10:107388406-107388428 CTGGAAATGGGAACTTTCCTTGG - Intergenic
1074495579 10:113977626-113977648 ATGCAAATAGGACCTTCCCTGGG + Intergenic
1075652718 10:124139800-124139822 CTGGAAAATGCATCTTCCCCAGG + Intergenic
1075786539 10:125053771-125053793 AGGGAAATGGGAACTTCACTTGG + Intronic
1075847876 10:125560675-125560697 CTTGAAATGGGATCTACTCCTGG + Intergenic
1076167377 10:128293369-128293391 CTGGAATTGGAAGTTTCCCTTGG + Intergenic
1076572101 10:131439625-131439647 CTGGAAAAAGGCTCTTCCCATGG + Intergenic
1079175502 11:18136737-18136759 AGGAAAATGGGATCTTCGCTAGG - Intronic
1079404877 11:20136117-20136139 CTGGAAGTAGAATGTTCCCTAGG + Intergenic
1080772961 11:35359825-35359847 CTGTGAATGAGATCTTCCTTAGG - Intronic
1080871491 11:36240790-36240812 CTGGAATGGGGATTCTCCCTGGG - Intergenic
1086337585 11:85814118-85814140 CAGGAATTGAGATCTTACCTTGG - Intergenic
1087845239 11:102964796-102964818 CTGGAAAGCGGGTCTTCCCCTGG - Intergenic
1091858193 12:3755833-3755855 CTGGACCTAGGCTCTTCCCTAGG + Intronic
1092387549 12:8047812-8047834 CACAAAATGGGATTTTCCCTGGG - Intronic
1096226824 12:49871359-49871381 CAGGAAACAGGCTCTTCCCTGGG + Intronic
1097159341 12:57035327-57035349 CTGGAAGATGGAACTTCCCTGGG + Intronic
1098471269 12:70846986-70847008 CTGGCATGGGGATCTTTCCTGGG + Intronic
1098657108 12:73045971-73045993 TTGGAAATGATATCTTCTCTGGG + Intergenic
1101736424 12:107466601-107466623 CTGCAAATGAGACCTGCCCTGGG + Intronic
1102612982 12:114128868-114128890 CTGGAAAGGGAAACTACCCTGGG - Intergenic
1103056287 12:117823679-117823701 TTGGAAATGATATCTTCTCTTGG - Intronic
1103224374 12:119274384-119274406 GTGGAAAGGTGATCTTCCCCTGG - Intergenic
1103611653 12:122127782-122127804 CTGGGAATGTGGTCTGCCCTAGG + Intronic
1106014018 13:25851065-25851087 CTGGAAATAGTTTATTCCCTTGG - Intronic
1107067818 13:36234595-36234617 CTGTAAAAGGGATCTTCAATAGG + Intronic
1107384273 13:39890874-39890896 CTGGAACTGGGAACTTGCCTAGG + Intergenic
1110995726 13:82106680-82106702 CTTGAGATGGGATCTACCCTTGG - Intergenic
1114536293 14:23425088-23425110 AAGGAAATGGGATATTCCCAAGG - Intronic
1116862634 14:50006993-50007015 CTGGAAATGTAATCTTTCTTCGG - Exonic
1117207241 14:53456331-53456353 CTAGAAATGAGATTTTCACTGGG + Intergenic
1119045632 14:71316182-71316204 CTTGAAATGTTTTCTTCCCTTGG - Intergenic
1121448759 14:93994826-93994848 CTGGTTATGGGACCTTCACTGGG - Intergenic
1122134002 14:99622183-99622205 CTGGAAATGTGATGTTCTCATGG + Intergenic
1122207333 14:100154508-100154530 ATGGAGGTGGGGTCTTCCCTAGG + Intronic
1124626715 15:31311967-31311989 CTGGATCTGAGATCTTCCCCGGG + Intergenic
1125719737 15:41839545-41839567 CTGGAAATGGGCTCTCTCCTGGG - Intronic
1126264668 15:46739758-46739780 CAGGAAATGTAATTTTCCCTGGG - Intergenic
1128245892 15:66132570-66132592 GTGGGAGTGGGAACTTCCCTGGG - Intronic
1128545308 15:68562382-68562404 CTTGAACTGGGAGCCTCCCTAGG + Intergenic
1129951250 15:79593630-79593652 CTGGAATTGGGAACTACACTGGG - Intergenic
1130170809 15:81511304-81511326 CTGGAGTTGGGATCTTTCCCAGG - Intergenic
1130746071 15:86655153-86655175 CCGGAAATGCATTCTTCCCTGGG + Intronic
1130996787 15:88908586-88908608 CTGGGCCTGGGATCTTCCCCAGG - Intronic
1131034282 15:89210941-89210963 CTGGAAATAGGACCTTCAGTGGG - Intronic
1135609980 16:23857795-23857817 CAGGAAATGGAAAATTCCCTTGG - Intronic
1136355739 16:29744166-29744188 CTGGGAAGGGCATCTTCGCTGGG + Exonic
1136720833 16:32318471-32318493 CTGGAAATGGCTCCTTACCTTGG + Intergenic
1137272861 16:46914134-46914156 GTAGAAATGGGACCTTCCCTCGG - Intronic
1137368077 16:47878166-47878188 CAGAAAATGAGTTCTTCCCTGGG + Intergenic
1139150109 16:64371822-64371844 ATGAAAATAGGATCTTTCCTTGG + Intergenic
1139391958 16:66610783-66610805 CTGTGGTTGGGATCTTCCCTAGG + Intronic
1139564263 16:67763487-67763509 CTGGAAGTGGGATCTGCTCAAGG + Intronic
1141160853 16:81628219-81628241 CTGGTCATGGGAGCCTCCCTGGG + Intronic
1141586298 16:85035681-85035703 GTAGAAATGGGATCTTGGCTGGG + Intronic
1203005599 16_KI270728v1_random:199299-199321 CTGGAAATGGCTCCTTACCTTGG - Intergenic
1203137149 16_KI270728v1_random:1735419-1735441 CTGGAAATGGCTCCTTACCTTGG - Intergenic
1150936034 17:69636792-69636814 CTGGAAATAGATTCTTCCCCAGG - Intergenic
1151312204 17:73300189-73300211 CAGGAAATGGGATCTGCCCCAGG - Intronic
1151949077 17:77338937-77338959 CTGGAGATGGGATCTACTCCAGG - Intronic
1152599146 17:81252745-81252767 TTAGAACTGGGTTCTTCCCTGGG + Intronic
1152892671 17:82891311-82891333 CAGAAAATGGGATATTCCCGTGG + Intronic
1153073992 18:1141916-1141938 CTGGAAGTGAAATCATCCCTAGG + Intergenic
1154490208 18:14916238-14916260 CAGGAAGTGTGATCTGCCCTGGG + Intergenic
1154972517 18:21424778-21424800 ATGGATATGGGATTTTTCCTTGG - Intronic
1156217328 18:35012996-35013018 CTTGAAATGCTATTTTCCCTTGG - Intronic
1158495319 18:57949960-57949982 CTGGAATTGGGGTGTTCTCTGGG + Intergenic
1159945112 18:74438917-74438939 CTGGAAAGTGGGTCTCCCCTTGG + Intronic
1160904060 19:1444208-1444230 CTGCTAATGGGTACTTCCCTTGG + Intergenic
1161876336 19:6913888-6913910 TTGGCAATGGGATATTCCCTGGG + Intronic
1162906298 19:13826001-13826023 CTGGGGATGGGGTCTTCACTTGG + Intronic
1163378234 19:16947356-16947378 ATGGAAAGGGGACCTTCCCGGGG - Intronic
1165127913 19:33613774-33613796 CTGGAAAGGGGGTGTCCCCTGGG + Intergenic
1166203260 19:41252518-41252540 CTGGAAGTTTGATCTTCCCAGGG - Intronic
924995346 2:355855-355877 CAGGAAATAGAATCTTCCCCAGG - Intergenic
931838761 2:66127397-66127419 CTGGAAATAGGACCTGCCCCAGG - Intergenic
932098845 2:68877944-68877966 CTTGAAATTGGATCTGTCCTAGG - Intergenic
932597367 2:73102349-73102371 CTGGCCATGGGAACTACCCTGGG - Intronic
932862601 2:75310445-75310467 CTGAAAATGGGAACCTCTCTTGG - Intergenic
933170608 2:79120921-79120943 GTGGAAAAGAGATCTTACCTTGG - Exonic
933769499 2:85734134-85734156 CTGGAACTGGATTCTTCCCTGGG - Intergenic
935075487 2:99739194-99739216 GTGGAAATGTGGTCTTTCCTGGG + Intronic
937034930 2:118773180-118773202 CTGGAATTGCGGTCATCCCTGGG - Intergenic
939639405 2:144621205-144621227 CTGTAAGTGGGCTCTCCCCTAGG - Intergenic
941547188 2:166866211-166866233 CTGGAACTCAGATCTCCCCTTGG + Intergenic
942313410 2:174676964-174676986 GTGGAAATGGGGTCTCCCTTTGG - Intronic
943626296 2:190204702-190204724 ATTGAAATGGGATCTTCGTTTGG - Exonic
947792055 2:232873976-232873998 CTGGAAAGGGGTTCTGCCTTGGG + Intronic
948710423 2:239821784-239821806 CTGGAATTGGGCTCCTTCCTGGG + Intergenic
1169053135 20:2597307-2597329 CCGGAAGTGGGAACTGCCCTGGG - Intronic
1171412838 20:24958261-24958283 AGGGACAGGGGATCTTCCCTGGG + Intronic
1174123435 20:48285040-48285062 ATGGTAATGGCATCTTCCCCAGG - Intergenic
1175690267 20:61060304-61060326 CTGGAACTGGGAGCTGCCTTTGG - Intergenic
1176063984 20:63184767-63184789 CTGGAAATGGGCTTTTCTGTGGG - Intergenic
1178585053 21:33864755-33864777 CTGGCAATAGCAACTTCCCTTGG + Intronic
1178881757 21:36455541-36455563 CTTGAAACGGGCTCTGCCCTTGG + Intergenic
1182491337 22:30674203-30674225 CTGGCAAAGGGATCTGCCCCAGG + Intergenic
1182570411 22:31233363-31233385 CTTGAAATGTTCTCTTCCCTTGG + Intronic
1183266128 22:36826801-36826823 CAGGAACTGTGACCTTCCCTGGG + Intergenic
1183763526 22:39847995-39848017 TTGGAAGTGGATTCTTCCCTAGG - Intronic
1184272424 22:43392446-43392468 CTGGGAATGGGACAATCCCTGGG - Intergenic
1184691344 22:46118690-46118712 CTGGATATGGTATCTTTACTCGG - Intergenic
952201296 3:31130835-31130857 CTGGACATGGCATATTCCCATGG + Intergenic
952228858 3:31408306-31408328 CTGAAAATGGAATTTTCCCTGGG - Intergenic
954902993 3:54035741-54035763 CTGGATCTGGGGTGTTCCCTGGG + Intergenic
955194284 3:56790708-56790730 CTTGAAATGGGAGCTTGCCCTGG + Intronic
956948924 3:74257488-74257510 CTGCAGATGGGAACTTGCCTGGG - Intergenic
959735696 3:109655269-109655291 GTGGGAATGTGATCTTCCCCTGG - Intergenic
959794074 3:110401592-110401614 GTGGAGATGGCAGCTTCCCTGGG - Intergenic
960458059 3:117898237-117898259 CTTGAAATGGAATCTACTCTGGG + Intergenic
960625253 3:119675971-119675993 CTGCAAATGGGAGATTGCCTGGG + Intronic
961499862 3:127324466-127324488 CTGTAAATGGAATCTCCACTGGG - Intergenic
965235921 3:166122842-166122864 CTGGAAATGTGATCTTCTCAAGG - Intergenic
967816790 3:193806158-193806180 GTGGAAATGTGTTCATCCCTAGG - Intergenic
970387615 4:15571673-15571695 TTGGAAATGCAATCTTCCCTAGG + Intronic
970615300 4:17763243-17763265 CTCTAAATTGGGTCTTCCCTGGG + Intronic
970712580 4:18880704-18880726 TTGGAAATGAAATCTTCTCTGGG - Intergenic
971532034 4:27701161-27701183 CTTGAGATGGGATGTTCCCCTGG + Intergenic
971750516 4:30641188-30641210 GTGGAAATGAGATTTACCCTAGG - Intergenic
975580907 4:75906322-75906344 GTGGAAAGATGATCTTCCCTTGG - Intergenic
976686612 4:87821313-87821335 ATGAAAATGGCATCTTCTCTTGG - Intergenic
978632683 4:110765392-110765414 CTGGAAATTGGACCTTCACTTGG - Intergenic
981020451 4:140022094-140022116 CTGGAATTTGCAACTTCCCTTGG - Intronic
981764422 4:148231864-148231886 CTTGAAATGGAATCTTCTCCTGG - Intronic
981849392 4:149210951-149210973 CTAGAAATGGGATCTTTCCCAGG - Intergenic
984373710 4:178899898-178899920 CTGGGAAGATGATCTTCCCTAGG + Intergenic
984417214 4:179477179-179477201 GTGGAAAAGTGGTCTTCCCTTGG - Intergenic
985016576 4:185642727-185642749 CTGGCAAAGAGATCTTCCTTAGG - Intronic
985017020 4:185647149-185647171 CTTGAAGTGGGATCATCGCTTGG + Intronic
985889045 5:2701571-2701593 CTGGAAATTGGCTCCTCCCATGG + Intergenic
987947537 5:24631101-24631123 CTGGAAATGGGATTGTACCCAGG + Intronic
990886095 5:60595081-60595103 CTTGGAAGTGGATCTTCCCTTGG - Intergenic
992210829 5:74478151-74478173 GTGGGAAGGTGATCTTCCCTTGG + Intergenic
992527473 5:77627054-77627076 AGGGAAATGGGATCTTTCATTGG - Intergenic
994221818 5:97204992-97205014 CTGGATCTGGGATCTTCCTTTGG + Intergenic
994248452 5:97508722-97508744 CTAGTAATGGAAACTTCCCTTGG + Intergenic
995069568 5:107904077-107904099 CTGGAAAGGGGATCTAGGCTTGG - Intronic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
998672921 5:144374069-144374091 CTTGAAATGGGATATTCTCCTGG - Intronic
1000064041 5:157680036-157680058 CTGGCAAAGGGATCTGCCCCAGG + Exonic
1000135178 5:158341220-158341242 TTGGAAATGGACTCTTCCCCAGG - Intergenic
1002391515 5:178916254-178916276 CACTAAATGGGCTCTTCCCTGGG - Intronic
1003147441 6:3520684-3520706 ATGGGAATGGGGTCTGCCCTTGG - Intergenic
1003226690 6:4212365-4212387 CTAGGAATGGGATCTTCCAATGG - Intergenic
1004174216 6:13324967-13324989 CTGAATATTGGATCTTCCCCAGG - Intronic
1004761254 6:18669122-18669144 CTGGAAAAGAGAGCTTTCCTCGG + Intergenic
1006025589 6:31144854-31144876 AGGGAAATGGGTGCTTCCCTTGG - Intronic
1010155572 6:72788309-72788331 CAGGCAAAGGGATCTTCCCATGG - Intronic
1010481132 6:76355624-76355646 CTGGAAAAGGAAGGTTCCCTGGG - Intergenic
1010608021 6:77916639-77916661 CTTGATATGGGATCTTCTTTTGG - Intronic
1012710676 6:102600040-102600062 CTGGAATTGGGATATTACTTTGG - Intergenic
1013146494 6:107399284-107399306 CTGAAAATGGGCTGTTTCCTGGG - Intronic
1013593832 6:111644082-111644104 CTGGAAATGTGATGTGGCCTGGG + Intergenic
1016258537 6:142139193-142139215 TTGGAAAAGTGATCTTCCCTGGG - Intergenic
1017247093 6:152238568-152238590 TTCTAAATGGGATTTTCCCTGGG - Intronic
1017747894 6:157463139-157463161 CTGGAAATGAGATCCTTCCATGG + Intronic
1021443489 7:20707406-20707428 CTGGCAATAGGCTATTCCCTTGG - Intronic
1022899259 7:34786245-34786267 CTTGAAATGGAATCTACTCTTGG - Intronic
1026607653 7:71829340-71829362 ATGGAAATGGATTCTTCCCTTGG + Intronic
1030015312 7:105213479-105213501 TTTGAACTGGGCTCTTCCCTTGG - Intronic
1030744479 7:113148483-113148505 CTGAAAATGATATCTTCACTTGG - Intergenic
1031681480 7:124680617-124680639 GTGGGAAGGGGGTCTTCCCTTGG - Intergenic
1031815167 7:126424676-126424698 CTTGAAATGGGATCTACTCCTGG - Intergenic
1034713247 7:153216152-153216174 CTGGAATTGGTATTTTTCCTTGG - Intergenic
1038247749 8:25874875-25874897 TTGGAGATGGGATCTTGCCTGGG + Intronic
1038909731 8:31949537-31949559 CTGGAAACAGTATCTTCTCTTGG + Intronic
1039487807 8:37925363-37925385 CTGGACATGGGATTTGGCCTGGG - Intergenic
1039799326 8:40940633-40940655 CTTGAAATTGCATCTTCCATGGG + Intergenic
1039832305 8:41224946-41224968 CTAGAAATGGTCTCTTCCCAGGG + Intergenic
1041034190 8:53771260-53771282 CTGGAAATAGAAACTTCTCTTGG - Intronic
1042238692 8:66640756-66640778 CTGGAAAGGTGGTCTTCCCCTGG - Intronic
1044910830 8:97056489-97056511 CTGGAAATGCATTCTTGCCTTGG - Intronic
1044913450 8:97086892-97086914 CTCAAAATGGGCTCTTCCCATGG - Intronic
1045190700 8:99880070-99880092 CTGGGGATGCCATCTTCCCTGGG - Intronic
1045343986 8:101278136-101278158 CTGGAAATGGGTCATTGCCTGGG + Intergenic
1046564653 8:115883626-115883648 GTGGAAATGGCATCTCACCTTGG - Intergenic
1049193123 8:141299888-141299910 CTGGAAAGGGGATCCTCCATTGG - Intronic
1049300387 8:141866609-141866631 CGGGAAGGGGGATCGTCCCTGGG + Intergenic
1049410532 8:142471956-142471978 CTGGAGGTGGGGTCATCCCTCGG + Intronic
1049927340 9:422043-422065 CTGGAAATCGGTCGTTCCCTAGG - Exonic
1050424223 9:5497419-5497441 CTGAAAATGGGAGGTTCACTGGG - Intergenic
1050522166 9:6512155-6512177 GTGCAAATTGGATCTTTCCTGGG - Intergenic
1050594003 9:7187916-7187938 CTGGAAGTGGTAGCTACCCTGGG + Intergenic
1051889895 9:21930881-21930903 CTGGAAATGGGATCTTCCCTGGG + Intronic
1052733692 9:32318695-32318717 ATGGACTTGGGATCTGCCCTGGG + Intergenic
1055807293 9:80110403-80110425 CTTGAGATGGAATCTTCCCCTGG - Intergenic
1056907674 9:90667152-90667174 CTGGGTAAGGGAGCTTCCCTTGG + Intergenic
1059254960 9:112921489-112921511 CTGTAAATGAGAACCTCCCTCGG - Intergenic
1060087098 9:120713615-120713637 CTGGACCTGGGATCCCCCCTCGG + Intronic
1062049957 9:134442163-134442185 CTGGAAAAGGGGTCGGCCCTGGG + Intergenic
1062477531 9:136736161-136736183 GTGGAAATGGCTGCTTCCCTGGG + Intergenic
1185782596 X:2862226-2862248 CAGGAAATGGATTCTCCCCTAGG + Intronic
1186310190 X:8309457-8309479 CTGGAATTTGGATCTTTCATTGG + Intergenic
1188183772 X:27088702-27088724 GTGGGAAGGGGATCTTCCCCTGG + Intergenic
1188505961 X:30885471-30885493 CTGGAAGTCTGAGCTTCCCTAGG + Intronic
1189166100 X:38862659-38862681 CTGGAAATGTTTTCTTCTCTTGG - Intergenic
1193107136 X:77688707-77688729 ATGAAAATGGTATCTGCCCTTGG - Intronic
1194781649 X:98030335-98030357 CTGGGCAGGGGAGCTTCCCTTGG + Intergenic
1195211424 X:102654736-102654758 CTGCTATTGGGATCTTCCCTGGG - Exonic
1195217589 X:102715611-102715633 CTGGTATTGGACTCTTCCCTGGG - Exonic
1196760439 X:119196359-119196381 CTGGTAAGGGCATCTTCCCATGG + Intergenic
1200100103 X:153685969-153685991 CTGGAACTGGGCTCTTCTCCAGG - Intronic