ID: 1051890174

View in Genome Browser
Species Human (GRCh38)
Location 9:21933190-21933212
Sequence TTTTTTCTTTTGAAGCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1196
Summary {0: 1, 1: 0, 2: 7, 3: 139, 4: 1049}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051890172_1051890174 -3 Left 1051890172 9:21933170-21933192 CCTGAACTCAGTAATCTAGCTTT 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1051890174 9:21933190-21933212 TTTTTTCTTTTGAAGCTGGATGG 0: 1
1: 0
2: 7
3: 139
4: 1049
1051890169_1051890174 20 Left 1051890169 9:21933147-21933169 CCCTATTTATTCATGGGCACCAT 0: 1
1: 0
2: 0
3: 20
4: 149
Right 1051890174 9:21933190-21933212 TTTTTTCTTTTGAAGCTGGATGG 0: 1
1: 0
2: 7
3: 139
4: 1049
1051890171_1051890174 1 Left 1051890171 9:21933166-21933188 CCATCCTGAACTCAGTAATCTAG 0: 1
1: 1
2: 6
3: 25
4: 153
Right 1051890174 9:21933190-21933212 TTTTTTCTTTTGAAGCTGGATGG 0: 1
1: 0
2: 7
3: 139
4: 1049
1051890170_1051890174 19 Left 1051890170 9:21933148-21933170 CCTATTTATTCATGGGCACCATC 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1051890174 9:21933190-21933212 TTTTTTCTTTTGAAGCTGGATGG 0: 1
1: 0
2: 7
3: 139
4: 1049

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051890174 Original CRISPR TTTTTTCTTTTGAAGCTGGA TGG Intronic
900410929 1:2512318-2512340 TTTTTTCATGTGGGGCTGGAGGG - Intronic
900727423 1:4226169-4226191 TTTTTTTTTTTTTAGATGGAGGG + Intergenic
900861013 1:5231283-5231305 TTTTTTTTTTTGTGGCTGGAAGG - Intergenic
900904713 1:5546798-5546820 TTTTTTCTTTCCAATTTGGATGG - Intergenic
901603064 1:10437403-10437425 TTTTTTTTTTTGGAGCAGGAGGG + Intronic
901605590 1:10456468-10456490 TTTTTTCTTTTTCACCTTGAGGG - Intergenic
902943919 1:19820246-19820268 TTTTTTTTTTTTGAGATGGAGGG + Intergenic
902968886 1:20032356-20032378 TTTTTTTTTTTGATGGTGGTAGG + Intronic
903013531 1:20347162-20347184 TTTTCTATTTTTATGCTGGATGG - Intronic
903296479 1:22346513-22346535 TTTTCTCTTTCAAGGCTGGAGGG + Intergenic
904175826 1:28628081-28628103 GTTTTTCCTGGGAAGCTGGAGGG - Intronic
904596511 1:31649571-31649593 TTTTTTTTTTTGGAGGTGGGGGG - Intergenic
904698794 1:32346093-32346115 TTTTTTCTTTTAGAGATGGGGGG - Intergenic
904715214 1:32462818-32462840 TTTTTTCTTATGAATGTGAAGGG - Intergenic
904720166 1:32501528-32501550 TTTTTTCTTTTTTAGCTGATGGG + Intronic
904779123 1:32931664-32931686 TTTTATCTTTTGTAGCCGCAAGG - Intergenic
905252668 1:36659503-36659525 CTTTTTCTAAGGAAGCTGGAGGG - Intergenic
905548912 1:38820280-38820302 TTTTTTTTTTTTAAGCTTCAGGG - Intergenic
905755220 1:40503559-40503581 TTTTTTTTTTTTAATTTGGAAGG - Intergenic
906054016 1:42900201-42900223 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
906372570 1:45266901-45266923 TATTTTTGTTTGAAGCTGGATGG + Intronic
906448019 1:45920497-45920519 TTTTTTGTTTTTAAGGTGCAAGG + Intronic
906552262 1:46674807-46674829 TTTTTTTTTTTTAAGGTGGTGGG + Intergenic
906820291 1:48922341-48922363 TTTTTTCTTCTGAAACTCAAGGG - Intronic
907210970 1:52821424-52821446 TTTTTTCTTTTTCAGCTTCAAGG + Exonic
907682822 1:56579713-56579735 TTTTTTTTTTTGAAGGGGGTGGG - Intronic
907990922 1:59582075-59582097 TTTTTTCTTTTTAAGAGAGAAGG - Intronic
908633821 1:66139724-66139746 TTTTTTTTTTTGAGGGGGGAGGG - Intronic
908849041 1:68355473-68355495 TTATTTCTTTTTAGGCTGGGAGG - Intergenic
909019380 1:70414129-70414151 TTTTTTTTTTTTAATCTGCAGGG + Intronic
909020290 1:70423562-70423584 TTTTTTTTTTTTAAGCAGCAGGG - Intronic
909372744 1:74903744-74903766 TTTTTTCTTTTCTAGTTTGATGG - Intergenic
910504968 1:87940016-87940038 CTTTTTCTTTTTAAGAAGGAAGG - Intergenic
910696374 1:90022041-90022063 TGTTTTCTTTTGAAGCTGATTGG + Intronic
910739042 1:90494945-90494967 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
910875953 1:91878265-91878287 TTTTTTCTTTTCATTCTGGAAGG - Intronic
911371479 1:96999683-96999705 TTTTTTCTTTTTGAGGTGGGGGG + Intergenic
911866028 1:103023371-103023393 TTTTTTTTTTTTGAGATGGATGG + Intronic
912072431 1:105828361-105828383 TTTTTACTTTTTAAACTAGAAGG - Intergenic
912172478 1:107117344-107117366 TTTGATCTCTTGGAGCTGGATGG + Intergenic
912247235 1:107972164-107972186 TTTTTGGTTTTGAATGTGGATGG - Intergenic
912340507 1:108909951-108909973 GTTTTACTTTTTAAGCTAGATGG - Intronic
913029649 1:114887661-114887683 TGATTTCTTTTGAAGCTCCATGG - Exonic
913156723 1:116106938-116106960 TTTTTTTTTTTAAACCAGGAAGG + Intergenic
913193157 1:116430642-116430664 TTTTTTTTTTTAAAGGTGGTAGG + Intergenic
914220008 1:145672774-145672796 TTCCTTCTTTAGAATCTGGAGGG + Exonic
914322406 1:146577893-146577915 ATTTTCCATTTGAAGGTGGATGG + Intergenic
914416725 1:147490952-147490974 TTCTTCCATTTGAAGCTGTAAGG + Intergenic
914455597 1:147833573-147833595 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
914472588 1:147995640-147995662 TTCCTTCTTTAGAATCTGGAGGG + Intergenic
914927116 1:151898154-151898176 CCTTTTCTTTTGCAGCTGGGAGG + Intronic
915284346 1:154843297-154843319 TTTTTTGTCTAGAACCTGGATGG - Intronic
915512782 1:156395599-156395621 TTTTTTTTTTTTAGGCTGGAAGG - Intergenic
915594248 1:156887383-156887405 CTTTTTCTTTGGAAGCAGGGAGG + Intergenic
916066420 1:161139609-161139631 TTTTTTTTTTTGAGGCAGCAGGG - Intergenic
916254585 1:162773676-162773698 TTTTTTCTTTTGAGATGGGAAGG + Intronic
916339588 1:163716204-163716226 TATTTTCTTTTCAAGCTGTTTGG + Intergenic
916384988 1:164256748-164256770 ATTTTTTTCTTGAAACTGGAAGG + Intergenic
916421044 1:164638068-164638090 CTTTTTCTTTGAAAGCTGTAAGG + Intronic
916422593 1:164650804-164650826 TTTTTTTTCTTGGAGGTGGAAGG - Intronic
916850479 1:168698111-168698133 TTTTCAGTTTAGAAGCTGGATGG - Intronic
917057933 1:171004166-171004188 CTTTTTCTTTTGCAGCTGGGAGG - Intronic
917144196 1:171870432-171870454 TTTTTTGTTTTTGAGATGGAGGG - Intronic
917322042 1:173792748-173792770 TGTTAATTTTTGAAGCTGGATGG - Intergenic
917328162 1:173854669-173854691 TTTTATTTTTTCAAGCTGCATGG - Intronic
917679499 1:177351392-177351414 TTTTTTTTTTTGAGGCAGGCAGG + Intergenic
917716564 1:177744263-177744285 TTTTTGCTTTTTAAGCTTGGTGG - Intergenic
917818029 1:178730562-178730584 TTTTTTTTTTTAAAACTGAAGGG - Intronic
917898541 1:179517375-179517397 TCTTTTCTTTTGCAGCTGGGAGG - Intronic
918315043 1:183316402-183316424 TGCTCTCTTTTCAAGCTGGAGGG - Intronic
918667096 1:187164728-187164750 TTTTTTTTTTTAAAGAAGGAAGG - Intergenic
919155359 1:193758171-193758193 TTTCAACTTTTTAAGCTGGATGG - Intergenic
919426102 1:197433064-197433086 TTTTTTTTTTTGAAGAGAGACGG + Intronic
919474086 1:198012984-198013006 TTTTTTTTTTTAATGCTGGCTGG + Intergenic
919696052 1:200576817-200576839 TTTTTTCTTTTGTAGAGAGAAGG + Intronic
919875087 1:201859652-201859674 TTTTTTCTTTTTAAGACAGATGG - Intronic
921079604 1:211728045-211728067 TTTTTTTTTTTAAAGCTATAGGG - Intergenic
921988529 1:221338814-221338836 TCTTATGTTTTGAAGCGGGAGGG + Intergenic
922531413 1:226348133-226348155 TTTTATCTGTTGGAGCTGGAAGG - Intergenic
922728327 1:227936657-227936679 TTTGCTCTGTTCAAGCTGGAGGG + Intronic
923220369 1:231887402-231887424 CTTTTCCATTTGAAGGTGGAAGG + Intronic
923808705 1:237288737-237288759 CCTTTTATTTTGCAGCTGGAAGG - Intronic
923916253 1:238509393-238509415 TTTTTTCTTCTCAAGCTTTAAGG - Intergenic
924319672 1:242836393-242836415 TTTTTTCTTCTGCAGATGGCAGG - Intergenic
924432829 1:244011309-244011331 TTTTTTTTTTTCCAGCAGGAAGG + Intergenic
924716899 1:246583946-246583968 TTTTTTCTTTTTAAGAGGCAAGG + Intronic
1062785503 10:261430-261452 TTTTTTTTTTTAAAGCTCTATGG - Intergenic
1063522706 10:6755313-6755335 TTTTCTCCTTTGAAACTTGAAGG - Intergenic
1063723707 10:8613489-8613511 TTTTTTTTTTTTTAGGTGGAGGG + Intergenic
1063888402 10:10603295-10603317 TTTCTCATTTTGAAGCTGCATGG - Intergenic
1064040495 10:11958549-11958571 TTTTTTCCTTTTAGGATGGAAGG - Intronic
1064249107 10:13693319-13693341 TTTTGTCTTTTGATGTTGGGAGG - Intronic
1064508377 10:16061105-16061127 TTTTTTCTATTGAGGCAAGATGG - Intergenic
1064526282 10:16260210-16260232 TTTTTTCTTCAGTAGCTGTATGG + Intergenic
1064538996 10:16387286-16387308 TTTTTTTTTTTGCAGGGGGAAGG + Intergenic
1064635508 10:17362184-17362206 TATTTCCTTTTTAATCTGGATGG - Intronic
1064922678 10:20535364-20535386 TTTTTACTTTGGCAGTTGGAAGG - Intergenic
1065350376 10:24790350-24790372 ATTTCTCTTTGGAAGTTGGAGGG - Intergenic
1065471031 10:26081489-26081511 ACTTTTCTTTTGCAGCTGGGAGG - Intronic
1066054227 10:31665485-31665507 TTTTTTCTATTGAAGGAAGAGGG + Intergenic
1066317274 10:34260278-34260300 TTTTTTCTTTTTAAACAGTATGG + Intronic
1066427422 10:35320648-35320670 TTTCTTCTTTTCAATCTGTATGG - Intronic
1066617910 10:37314586-37314608 TTTCTTTTATTGAAGGTGGAGGG + Intronic
1066658416 10:37716616-37716638 TTTTTTCATTTGAAAGTAGAAGG + Intergenic
1066762284 10:38766867-38766889 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1066814233 10:39383137-39383159 TTTTTTCTGTAGAATCTGCAAGG - Intergenic
1066959306 10:42205603-42205625 AATTTCCTTTGGAAGCTGGATGG + Intergenic
1067022026 10:42809382-42809404 TTCTTTCTTTTCAACCTGTATGG + Intronic
1067042916 10:42966301-42966323 TTTTTTCATTTGAAAGTGGAAGG + Intergenic
1067434127 10:46265328-46265350 TTTTTTTTTTGCAAGGTGGATGG + Intergenic
1067439570 10:46301006-46301028 TTTTTTTTTTTCAAGGTGGATGG - Intronic
1067736661 10:48859182-48859204 TTATTTCTTTTCAATCTGTATGG + Intronic
1068018849 10:51554938-51554960 TTTTTTCTTTTGAAATTTCAAGG - Intronic
1068077104 10:52270075-52270097 TTTTTTCTCTTTAAACTGTAGGG + Intronic
1068807307 10:61212128-61212150 TTTTTTCTCTGGAAGCTCTAGGG - Intergenic
1068941886 10:62688750-62688772 TTTTTTCTTTTGAGGCTTATGGG - Intergenic
1068953113 10:62797711-62797733 TTTTTTTTTTTAATGCTGGAAGG + Intergenic
1069399305 10:68025644-68025666 TGTTTACTTTTGGAGCTGGAGGG - Exonic
1069432238 10:68348191-68348213 TTTTTTTTTTTAATGCAGGACGG + Intronic
1069484664 10:68813961-68813983 TTTTTTTTTTGGTAGCCGGAAGG + Intergenic
1070230283 10:74558808-74558830 TGATTTCTTTTGAAGCTCCAAGG - Intronic
1070948143 10:80409515-80409537 TATTTTCCTTTGAACCTGGCAGG + Intronic
1071341494 10:84653097-84653119 TTTTTTCTTTGGAAGCCTGTAGG + Intergenic
1071664010 10:87535753-87535775 TTTTTTCTTTTGTAGAGGTAGGG - Intronic
1071688194 10:87784988-87785010 TGTTTGCTTGTGAAGGTGGAGGG - Intronic
1071692271 10:87833657-87833679 TTTTTTTTTTTTAATCTGAATGG + Intronic
1072343061 10:94474493-94474515 GTTTTTTTTTTGGAGGTGGAGGG - Intronic
1072414093 10:95232426-95232448 TTTTTTTTTTTAAAGCAGGCAGG - Intergenic
1072676943 10:97474121-97474143 TTTTTTTTTTTGAGGCAGGCTGG - Intronic
1072960883 10:99928013-99928035 TTTTTTCTTTTTTAGCTGGAAGG + Intronic
1073191180 10:101651516-101651538 TTTTTTCTTTTGAAACCAGGAGG + Intronic
1073306235 10:102504930-102504952 CTTTTGCTTTTGAAGTTTGACGG + Intronic
1073847427 10:107573739-107573761 TTTTTTTTTTTGTGGCTTGATGG - Intergenic
1073993391 10:109289292-109289314 TTTTTTCTTTTGAATTTCAAAGG - Intergenic
1074259015 10:111833448-111833470 TTTTTTTTTTTTAATTTGGAGGG - Intergenic
1074779706 10:116792602-116792624 TTTTTTTTTTTGTAGATGCAAGG - Intergenic
1074936901 10:118190743-118190765 TTCTTTCTTTTGTAGCTGAAGGG + Intergenic
1076012542 10:127002140-127002162 TTTTTTCTTTTCCACCTTGATGG + Intronic
1076199126 10:128544343-128544365 TTTTTTCTTTTAAAACAGCACGG + Intergenic
1076237876 10:128879792-128879814 GTTTTTCTCATCAAGCTGGAAGG + Intergenic
1077643791 11:3905374-3905396 TTTTTTTTTTTAAAGGTGGAGGG + Intronic
1077988286 11:7377569-7377591 TTTTTGCGTTTGAAGCTGGTGGG - Intronic
1078010938 11:7572623-7572645 GATTTTCTTTTGTAGGTGGAGGG - Intronic
1078041935 11:7873669-7873691 TTTTATCTTTTATAGCTGGGAGG - Intergenic
1078223431 11:9370839-9370861 TCTTTTTTTTTGGAGATGGATGG - Intergenic
1078234474 11:9471554-9471576 TTTTTTTTTTTGAAACGGGACGG + Intronic
1078601784 11:12738670-12738692 TTTTTTCATCTGAAACTGAAAGG - Intronic
1078879737 11:15436385-15436407 GTTTTTATTTTGAAGGTGGGAGG + Intergenic
1079015944 11:16868771-16868793 TCTTCTCCTTGGAAGCTGGATGG + Intronic
1079180073 11:18184803-18184825 TTTATACTTCTGAAGCTTGAAGG + Intronic
1079500661 11:21097965-21097987 TTTTTTTTTTTGGAGTTGGGAGG - Intronic
1079788058 11:24700651-24700673 TTGTTTTTTGTGAAGCTGAATGG + Intronic
1079791764 11:24747981-24748003 CCTTTTCTTTCAAAGCTGGAAGG - Intronic
1079952207 11:26819442-26819464 TAATTTCTTTTGCAGCTGGGAGG - Intergenic
1080153086 11:29076510-29076532 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
1080332820 11:31159769-31159791 TTTTTTCTTTTTTTGGTGGAAGG - Intronic
1080902839 11:36511681-36511703 TTTTATTTTTTAAAGCTGGGTGG - Intronic
1080969888 11:37260360-37260382 TTTTTTCTTTTGAAAATAGCAGG + Intergenic
1081271715 11:41093193-41093215 TTTTTCCTTTGAAAGATGGATGG - Intronic
1081725873 11:45328696-45328718 TTGTTCCTTTTGATGCTGGTGGG + Intergenic
1081926971 11:46838606-46838628 TTTTTTTTTTTGAAGAGGCAAGG - Intronic
1082887339 11:58100850-58100872 TTTTTTCATTTGCAGCAGCATGG + Intronic
1082982932 11:59140499-59140521 TTTTTTCTTTTGAAAAGGTAGGG + Intergenic
1083013529 11:59427081-59427103 TTTTTTTTAATGAGGCTGGATGG + Intergenic
1083127507 11:60586032-60586054 TTTTTTCTTTTCAATTTGGATGG - Intergenic
1083155015 11:60817335-60817357 CTTTTCCTTTTGAAGCTGAATGG + Intergenic
1083336969 11:61928149-61928171 TTTTTTTTTCTGTAGCAGGAAGG - Intergenic
1083539361 11:63501663-63501685 TTTTTTTTTTTTGAGATGGATGG + Intergenic
1083561998 11:63680540-63680562 TTTTTTTTTTTAAGGCAGGAAGG + Intergenic
1083930983 11:65845124-65845146 TTTTTTTTTTTAAAGCAGGGGGG - Intronic
1084059373 11:66660139-66660161 TTTTTTTTTTTAAATCTGAAGGG + Intronic
1084626262 11:70310113-70310135 TTTTTTGTTTTGACTCTGAAGGG - Intronic
1085165652 11:74397754-74397776 TTTTTTTTTTTGAAGAAAGAGGG + Intronic
1085178230 11:74509236-74509258 TTTTTTGTTTTGAGGATGTAGGG - Intronic
1085308029 11:75499405-75499427 TTTTTTTTTTTTTAACTGGAAGG + Intronic
1085559993 11:77462821-77462843 TTTTTTTTTTTGGAGATGGAGGG - Intronic
1085601268 11:77858317-77858339 TTTTTTTTTTTGTAGTTGCAAGG + Intronic
1085970121 11:81579240-81579262 TTTTTTCTTTTAATGTTTGAAGG - Intergenic
1086518181 11:87638736-87638758 TTTTTTTTTTTGTAGATGCAGGG + Intergenic
1086722794 11:90142168-90142190 ATTTTTCTTTTTTAGCTGGTCGG + Intronic
1087280975 11:96209797-96209819 TTCTTTCTTTTCCTGCTGGAGGG - Intronic
1087283687 11:96241459-96241481 TTTTAACTTTTGTAACTGGAGGG + Intronic
1087554978 11:99706843-99706865 TTTTTTTTTTTTAAGCTATAAGG + Intronic
1088015782 11:105057958-105057980 TTTTTTCTTTTCCAGAAGGAAGG - Intronic
1088268683 11:108011631-108011653 TTTTTTTTTTTGGAGGGGGACGG + Intronic
1088400295 11:109416204-109416226 TTTTTGATGTTGAAGATGGAGGG - Intergenic
1088589326 11:111389355-111389377 TTTTTTCTTTTGGACCTTCAAGG - Intronic
1088786721 11:113188975-113188997 TTTGTTCTCCTGAAGATGGAAGG + Intronic
1089023056 11:115238260-115238282 TCTTTGCTTCTGAAGCTTGAGGG + Intronic
1089180889 11:116582147-116582169 TGTTGTCTTTAGAAGCTGGTGGG + Intergenic
1089234757 11:117013984-117014006 TTTTTTTTTTTGAGACAGGATGG + Intronic
1089551256 11:119280311-119280333 TATTTTGTTTTTTAGCTGGATGG + Intronic
1090505396 11:127306942-127306964 TTTTTTTTTTTGAAGGGGGAAGG - Intergenic
1090518244 11:127451452-127451474 TTTTTTTTTTTGAGGCTGTTAGG - Intergenic
1090605321 11:128417014-128417036 TTTTTTCTTTTGAGGAAAGAGGG - Intergenic
1090891829 11:130930450-130930472 TTTTTTCTTCTAAATCTAGAGGG + Intergenic
1091195828 11:133729935-133729957 TTGATTATATTGAAGCTGGAAGG + Intergenic
1092067911 12:5607425-5607447 TTTTTTTTTTTTAAGTTAGATGG + Intronic
1092100726 12:5881702-5881724 TTTCTCCTGTTGGAGCTGGAGGG - Intronic
1092200962 12:6582492-6582514 TTTTCTCTGTTGAAGTTGGCAGG - Intronic
1093043668 12:14415695-14415717 TTTTTTTTTTTTAAGATGGCAGG + Intronic
1093235093 12:16600280-16600302 TTTTTTTTTTTGGAGCTTAAGGG - Intronic
1093389544 12:18602103-18602125 CCTTTTCTTTTGCAGCTGGGAGG + Intronic
1093490555 12:19700172-19700194 TTTTATCTCCTGAAACTGGACGG - Intronic
1093629499 12:21391724-21391746 TTTTTTCTTTTGAATGTCAACGG - Intronic
1093750813 12:22797814-22797836 TTTTTTTTTTTGAGGCTGGTGGG - Intergenic
1093762991 12:22931217-22931239 TTTTTTCTTTTAAAATGGGAAGG + Intergenic
1093974646 12:25407913-25407935 TTTTTTTTTTTTGAGATGGAGGG + Intergenic
1094059778 12:26301338-26301360 TTTTTTTTTTGGAAGCAAGAGGG + Intergenic
1094087927 12:26614186-26614208 TTTTTCCCTTAGAAGATGGAGGG - Intronic
1094094287 12:26686599-26686621 GTTTTTTCTTTGAAGTTGGAGGG + Exonic
1094310733 12:29078560-29078582 CTTTTTGTTTTGAAGCTGTTTGG - Intergenic
1094376644 12:29797413-29797435 TTTTTTCCTTTAAAGTTGCAAGG + Intergenic
1094463405 12:30723300-30723322 TTTGTTCTTTAGATGCTGCAAGG + Exonic
1094566273 12:31601069-31601091 TTTTTTTTTTTTTAACTGGACGG - Intergenic
1095265313 12:40149782-40149804 TTTTTTCTTTATAAATTGGATGG - Intergenic
1095665132 12:44788726-44788748 TCTGTTCTTTTGCAGCTGGGAGG + Intronic
1095759248 12:45809803-45809825 TTGTGTCTTGTAAAGCTGGAAGG + Intronic
1096200981 12:49682778-49682800 TTTTATCTTTTGAAGGGGCAAGG - Intronic
1096245457 12:49982675-49982697 TTTCTTCTTTTGAAAATGAAAGG - Intronic
1096288090 12:50317655-50317677 TTTTTTCTTTTTAAGAGAGATGG + Intergenic
1096310316 12:50514956-50514978 GTGTTTTTTTTAAAGCTGGAAGG - Intronic
1096783243 12:54002792-54002814 GTTTTTCTTTTTAAGCTGATTGG - Exonic
1097243638 12:57592904-57592926 TTTTTTTTTTTTAATCTGGAGGG + Intronic
1097646726 12:62243960-62243982 TTTTGTCTTTTGTAGATGCAGGG + Intronic
1097760493 12:63459243-63459265 CCTTTTCTTTTGCAGCTGGGTGG + Intergenic
1097884668 12:64717092-64717114 TTTTTTCTTTTGAGGGAGTAGGG + Intronic
1097886755 12:64736577-64736599 TTTTTCCTTTTGAAGTTTGCAGG - Intronic
1098003200 12:65967738-65967760 ATTTTTCTTCTGAAGTAGGAGGG + Intergenic
1099227148 12:79983176-79983198 TTTTTTCTTTTGTAGATACAGGG + Intergenic
1099502821 12:83434383-83434405 TTTTTTTTTTTGCTGTTGGAGGG + Intergenic
1099708445 12:86187739-86187761 TTTTTTTTTTTGCAGTTGGAAGG - Intronic
1099832563 12:87863727-87863749 TCTTTTCTTTTGAAAGGGGATGG + Intergenic
1099955152 12:89346066-89346088 TTTCTTCTGTGGAAGGTGGAAGG - Intergenic
1100123675 12:91397520-91397542 TTTTTTCTTTTTAAACTTGGGGG - Intergenic
1100245374 12:92752017-92752039 TTTTTTTTTTTTAAGGGGGATGG - Intronic
1100291046 12:93215165-93215187 TTTTTTCTCTTGCAGCTGGGAGG - Intergenic
1100361181 12:93881004-93881026 ATTCCTTTTTTGAAGCTGGAGGG + Intronic
1100459805 12:94788135-94788157 TTTTTCCTTTTGCAGATAGATGG + Intergenic
1100466807 12:94853390-94853412 ATTTTTCTTATGATGCTGGAAGG - Intergenic
1100680725 12:96917019-96917041 TTTTATCTTGAGAAACTGGATGG + Intronic
1100833747 12:98545137-98545159 TTTTTTTTTTTGGAGTGGGAGGG + Intronic
1101304013 12:103509366-103509388 TTTTTTCCTTTGAAAATGGCAGG - Intergenic
1101434210 12:104651332-104651354 TTGTTTCTTTGGAAGCTGCTTGG + Intronic
1101608453 12:106268354-106268376 TTTTTTTTTTTTGAGATGGATGG - Intronic
1101761366 12:107661480-107661502 TTTTTTTTTTTGAAAGAGGAAGG - Intergenic
1101934004 12:109041118-109041140 TGTTTTCTTTCTAATCTGGAAGG - Intronic
1102020927 12:109682110-109682132 TTTTTTTTTTTGATCTTGGAAGG - Intergenic
1102750991 12:115294465-115294487 TTTTTTTTTTTGATGCTTGCTGG + Intergenic
1103037089 12:117665360-117665382 TCTTTTTTTTTAAAGCAGGAAGG + Intronic
1103117187 12:118345681-118345703 TTTTTTTTTTTCAAGCAGGATGG - Intronic
1103820811 12:123697072-123697094 CTTTTTCTTTTATAGCTGGAAGG + Exonic
1103849557 12:123923324-123923346 TTTTGGCTTTGGAAGCTAGATGG - Intronic
1103917471 12:124383523-124383545 TTTTTTTTTTTTGAGTTGGAAGG - Intronic
1104305225 12:127603981-127604003 TTTTTTTTTTTGAGGGTGGGAGG + Intergenic
1104742177 12:131185713-131185735 TTTTTACTTTAGTAGCTGTAGGG - Intergenic
1106052750 13:26206906-26206928 TTTTTTTTTTTTAAGGAGGAAGG - Intronic
1106167239 13:27258947-27258969 TTTTTTCTAATGAAGCGAGATGG + Intergenic
1106271934 13:28162857-28162879 TTTTTTTTTTTTAAGCTTGGTGG - Intronic
1106342098 13:28840033-28840055 TTTTTTTTTTTAAAGCTGTGAGG + Intronic
1106847898 13:33756605-33756627 TTTTTTTTTTTGGAGATGGGGGG - Intergenic
1107452908 13:40527688-40527710 TTTTTTTTTTTGGAGACGGACGG - Intergenic
1107665256 13:42681799-42681821 TTTTTTTTTTTGGAGCTTAATGG - Intergenic
1107666282 13:42694087-42694109 CCTTTTCTTTTGCAGCTGGTAGG - Intergenic
1107713757 13:43177986-43178008 TTTTTTCTTTTTATTCTAGAAGG - Intergenic
1107833622 13:44396422-44396444 TTTTTTTTTTTGAAGGAGGGTGG - Intronic
1107991703 13:45824480-45824502 TTCCTTCTTTGTAAGCTGGAAGG + Intronic
1108141414 13:47426431-47426453 TTCATTCTTTTGAATCTGGGTGG - Intergenic
1108191068 13:47939511-47939533 TTTTTTCATATGAAGCGGGTAGG + Intronic
1108288332 13:48931285-48931307 TTTTTTCCTCTGAAACTGCAAGG - Intergenic
1108306848 13:49145522-49145544 TTTTTTCTTTTGACTATGTATGG + Intronic
1108525786 13:51284898-51284920 TTTTTTTTTTTGAGACAGGAAGG + Intergenic
1108541403 13:51451166-51451188 ATTTTTCTTTTCAGGCTGGATGG - Exonic
1108825491 13:54407977-54407999 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
1109011956 13:56960775-56960797 TTATTTCTTTTGAAGAAAGAAGG + Intergenic
1109384171 13:61606649-61606671 GTTTTTGTTTTCAAGATGGAAGG + Intergenic
1109634237 13:65092568-65092590 TTTTTTGTTTTGAAGATAGATGG + Intergenic
1109657246 13:65409165-65409187 TTGTTACTTTTCAAGCAGGATGG + Intergenic
1109704477 13:66072055-66072077 TTCTGACTTGTGAAGCTGGATGG + Intergenic
1109992404 13:70075215-70075237 GATTCTCTTTGGAAGCTGGATGG + Intronic
1110034937 13:70672052-70672074 TTTTTTGGTTTGAAGCTTTAGGG + Intergenic
1110059317 13:71021622-71021644 TTTGTGATTTTAAAGCTGGAGGG - Intergenic
1110093530 13:71485588-71485610 TTTTTTTTTTTTTAGCTGGAGGG + Intronic
1110604106 13:77410988-77411010 TTTTGTCTTTTGCAGATGGTAGG - Intergenic
1111455837 13:88482985-88483007 TTGTTTCTTTTTAAGCTGTAGGG - Intergenic
1112125733 13:96465681-96465703 TTTCTGCTTTTGAACCTGGGTGG + Intronic
1112212883 13:97398539-97398561 TTTTTTGGTTTGCAGCTGCATGG + Intergenic
1112500044 13:99935810-99935832 TTTTTCCTTTTTTAGCTGTAGGG - Intergenic
1112602420 13:100869395-100869417 TTTTTTTTTTTTTGGCTGGAGGG + Intergenic
1112738040 13:102443205-102443227 CCTTTTCTTTCGCAGCTGGAAGG + Intergenic
1112816057 13:103274871-103274893 TCTTTCCCTTTGGAGCTGGAAGG + Intergenic
1114175803 14:20318463-20318485 TTTTTTTTTTTAAAGACGGAGGG - Intronic
1114230207 14:20774443-20774465 TTTTTTTTTTTGAGGCTGGCTGG - Intergenic
1114230214 14:20774511-20774533 TTTTTTTTTTTGAGGCTGGCTGG - Intergenic
1114441507 14:22751945-22751967 TTTTTTTTTTTGGAGATGGCAGG + Intergenic
1114807054 14:25849712-25849734 TTTCTTACTTTGAAGGTGGATGG + Intergenic
1114880747 14:26782364-26782386 TTTTTTTTTTTTAAACTGAAAGG + Intergenic
1114973328 14:28061901-28061923 TTTCTTCTTCTGCTGCTGGATGG + Intergenic
1115022880 14:28704319-28704341 TTTTTTTCTTTGAAGCTTTAAGG - Intergenic
1115054983 14:29113361-29113383 TTTTTTTTTTTTAAGCTTCATGG + Intergenic
1115243553 14:31272570-31272592 TTTCCTCTTTTGTAGCTGCAAGG - Intergenic
1115265116 14:31492838-31492860 CCTTTTCTTTTGCAGCTGGGAGG + Intronic
1115765797 14:36622515-36622537 TTCTTTCTTTTCAAACTGTATGG + Intergenic
1115969765 14:38932346-38932368 CCTTTTCTTTTGAGGCTGGTAGG + Intergenic
1116346657 14:43803010-43803032 TACTTTCTTTTGTAGCTGGAAGG + Intergenic
1116772030 14:49137813-49137835 TTTTTTCTTTTGTATTTTGATGG + Intergenic
1117509243 14:56432094-56432116 TTTTTGTTTTTGCAGCTGCAAGG - Intergenic
1117609487 14:57467687-57467709 TTCTTTCTTTTATAGCTAGAAGG + Intergenic
1118064910 14:62180249-62180271 CCTTGTCTTCTGAAGCTGGATGG + Intergenic
1118162267 14:63302138-63302160 CCTTTTCTTTGGAAGCTGGGAGG + Intergenic
1118404494 14:65410583-65410605 TTTTTTTTTTTTCAGTTGGAAGG + Exonic
1118944727 14:70373794-70373816 TGTTTCCTTTTGAGGCTGGATGG + Intronic
1119891723 14:78187788-78187810 TTTTTTTTTTTGAGGTTGGGTGG + Intergenic
1120147567 14:80995872-80995894 TTTTTTCTTTTGTAGCAAGAAGG - Intronic
1120645983 14:87074844-87074866 TGTGTTCTTTTGAATCAGGAAGG + Intergenic
1121107045 14:91287651-91287673 TTTTTTTTTTTGCATCTGAAGGG + Intronic
1121116375 14:91345919-91345941 TTTTTTTTTTTGAACCTGAAAGG - Intronic
1121266368 14:92604931-92604953 TTTTTTTTTTTTGAGATGGAGGG + Intronic
1121552669 14:94814147-94814169 TTTGTTCTCTTGATGCTGGGTGG + Intergenic
1121666872 14:95679206-95679228 TTTTTTTTTTTTAAGGTAGAAGG - Intergenic
1122683433 14:103485265-103485287 TTTTTTTTTTTTAAGATGGATGG + Intronic
1122761166 14:104028028-104028050 TTTTTCTTTTTGTAGCTGAATGG + Intronic
1202933617 14_KI270725v1_random:63120-63142 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1123663043 15:22582202-22582224 TTATTTCTCCTGAAGTTGGATGG + Intergenic
1124261227 15:28193735-28193757 TTATTTCTCCTGAAGTTGGATGG - Intronic
1124316845 15:28676505-28676527 TTATTTCTCCTGAAGTTGGATGG + Intergenic
1125008019 15:34839662-34839684 TCATTTCTTTTGCAGCTGGTAGG + Intergenic
1125045055 15:35235707-35235729 TTTTAGCTTTTGAAAATGGAGGG + Intronic
1126072098 15:44874238-44874260 TATGTTCTTTTCAAGCTGTAGGG - Intergenic
1126161711 15:45619957-45619979 TTTTTTTTTTTTTAGCGGGAGGG - Intronic
1126497043 15:49303248-49303270 TTTTTAGTTTTGAAGGGGGAAGG - Intronic
1126540146 15:49813365-49813387 TTTCTTCTTTTTATGCTGGCAGG + Intergenic
1127605160 15:60579453-60579475 ATTTTTTTTTTTAAGCAGGAAGG - Intronic
1127661132 15:61101359-61101381 TTGTTTATTTTGAGACTGGAAGG + Intronic
1127803354 15:62496344-62496366 TAATTTCTTTTTAAGCTGTACGG - Intronic
1128238668 15:66084863-66084885 CCATTTCTTTTGCAGCTGGAAGG + Intronic
1128506992 15:68279586-68279608 TTTTTTCTTTTGAAGTCAGTAGG + Intronic
1128817031 15:70617882-70617904 TATTTTCTTTGCAAGATGGAAGG + Intergenic
1128939897 15:71779438-71779460 GGTTTTCTTTTCATGCTGGAGGG + Exonic
1129010823 15:72415335-72415357 TTTTTTCTTTTTGAGAAGGAGGG - Intergenic
1129021576 15:72524249-72524271 TTTTTTTTTTTTGAGATGGATGG + Intronic
1129545805 15:76393659-76393681 CTCCTTTTTTTGAAGCTGGATGG + Intronic
1129925153 15:79357453-79357475 TTTTTTTTTTTGAGGCAGGGTGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130246455 15:82254447-82254469 TTTTTCCTTTTGAAATGGGATGG - Intronic
1130454168 15:84088510-84088532 TTTTTCCTTTTGAAATGGGATGG + Intergenic
1130604428 15:85302469-85302491 ATTTGTCTTCTGAAGTTGGAGGG - Intergenic
1130658868 15:85814167-85814189 TTTTTTTTTTTTAATCAGGACGG - Intergenic
1130711976 15:86292308-86292330 TTTTTGGCTTTGAAGGTGGAGGG + Intronic
1131484702 15:92809955-92809977 TTTTTTTTTTTGACGGTAGATGG + Intergenic
1131498544 15:92936838-92936860 TTTTTTTTTTTGATGGAGGAGGG + Intronic
1131536344 15:93241050-93241072 GTTTTTCTTTTAACGCTGGGTGG + Intergenic
1131657188 15:94473957-94473979 TTTTTTTTTTTTAAACTGTAGGG + Intronic
1131694192 15:94856957-94856979 TTTTTTTTTTTTTAGCTAGAAGG - Intergenic
1131698958 15:94911415-94911437 TTTTCTCTTTTGAAGATGAAGGG - Intergenic
1131953039 15:97702356-97702378 TTGTTTCTTTTGAAACGGTAAGG - Intergenic
1132319570 15:100915973-100915995 TTTTTGTTTTTGAAGCTATATGG - Exonic
1132358865 15:101195523-101195545 TTTTTTATTTAAAAGCTGGCCGG + Intronic
1133325862 16:4941902-4941924 TTTTTTTTTTTTGAGATGGATGG + Intronic
1133494136 16:6299999-6300021 CCTTGTCTTTTGAAGCTGAATGG - Intronic
1133599868 16:7328633-7328655 TTTTTTTTTTTTTAGGTGGAGGG + Intronic
1133632750 16:7637260-7637282 TTTTTTTTTTTGAGGAGGGAAGG - Intronic
1133981677 16:10637330-10637352 TTTTTTTTTTTAAAGCGGGCTGG - Intronic
1134241217 16:12508433-12508455 TTTTTTCTGTTGCTTCTGGATGG + Intronic
1134367495 16:13592917-13592939 TTCTTTCTTCTGAGGATGGACGG - Intergenic
1135284788 16:21184136-21184158 TATTTTCTTTAGAAACTGAATGG + Intergenic
1135601594 16:23788398-23788420 TTTTTTTTTTTTTGGCTGGAAGG + Intergenic
1135604149 16:23808736-23808758 TTTTTTCTTTTTAAGTTCCACGG - Intergenic
1135612977 16:23884711-23884733 TTTTATTTTTTGTAGCTGCAAGG + Intronic
1135826065 16:25730042-25730064 TATTTTATTTTGAAACTGGATGG + Intronic
1136116264 16:28096838-28096860 CTTTTTCCTTTGGAGATGGAGGG - Intergenic
1137308764 16:47232356-47232378 TTTTCTTTTTTGAAGTAGGAGGG + Intronic
1137403831 16:48174995-48175017 TTTATTTTTTAGAAACTGGATGG - Intronic
1137468884 16:48736792-48736814 TTTTTTTTTTTGTTGCTTGATGG + Intergenic
1138836481 16:60442203-60442225 TTTATTCTTCTGAGACTGGAAGG - Intergenic
1139047584 16:63081370-63081392 TTTTTTTTTTTTAAGCTACAAGG - Intergenic
1139565377 16:67772079-67772101 TTTTTTTTTTTGAAGTTACATGG - Exonic
1139704929 16:68734760-68734782 TTTTGTCTTTTGATGGAGGACGG + Intergenic
1140011217 16:71133276-71133298 ATTTTCCATTTGAAGGTGGATGG - Intronic
1140377115 16:74453433-74453455 TCTTTTCTTTTGGAGAGGGAGGG + Intronic
1140467973 16:75197263-75197285 TTTTATCTCTTGCAGCTGCAAGG - Intergenic
1141583442 16:85016626-85016648 TTTTTTTTTTTAAAGATTGAGGG + Intergenic
1142206678 16:88786103-88786125 TTTTTTTTTTTTGAGCTGGAGGG - Intergenic
1203137790 16_KI270728v1_random:1740184-1740206 GTTTTTCTGGTAAAGCTGGAAGG - Intergenic
1142552580 17:750184-750206 TTTTTTTTTTCGGAGATGGAGGG - Intronic
1143359343 17:6355293-6355315 TATTTTATTTTCAAGGTGGAGGG + Intergenic
1143412217 17:6716489-6716511 TTTTTTTTTTTGCAGGGGGACGG - Intergenic
1143659242 17:8314731-8314753 TTTTTTTTTTTGAAGGGGAAAGG - Intronic
1144273306 17:13640861-13640883 GATTCTCTTTGGAAGCTGGATGG - Intergenic
1145102853 17:20091140-20091162 ATTTTTCTTCTGATGCTGTATGG + Intronic
1146394330 17:32450908-32450930 TTTTTTTTTTTAAAGCAGCATGG + Intronic
1146399300 17:32490851-32490873 CTTTTTCTTGTAAACCTGGAGGG + Exonic
1146429393 17:32776727-32776749 TTATTTTCTTTGAAGCTGTATGG + Intronic
1146583345 17:34059557-34059579 CCTTTTCTTTTGCAGCTGGGAGG + Intronic
1146683804 17:34826945-34826967 ATTTTCCTCTTGGAGCTGGAAGG - Intergenic
1146818208 17:35961950-35961972 TTTTTTCTTTTTAACCTGGCAGG - Intergenic
1146838385 17:36131292-36131314 TTTTTTTTTTTGCTGCTGGGGGG - Intergenic
1147112802 17:38276222-38276244 TTTTTTTTTTTGAAGTAGGAAGG - Intergenic
1147676800 17:42212243-42212265 GTTTTTCTTTTGTGGCTTGAGGG - Intronic
1147891175 17:43718016-43718038 TTTTTTCAGTTTGAGCTGGATGG - Intergenic
1148602240 17:48903214-48903236 TTTTTTTTTTTGAGGTGGGATGG - Intergenic
1148652739 17:49261230-49261252 TTTTTTCTATGGCATCTGGAAGG + Intergenic
1149002075 17:51767727-51767749 TTTTTTTTTTTGCAACTAGATGG + Intronic
1149108711 17:52999478-52999500 TATTTTCTTTTTATGCTTGAAGG - Intergenic
1149952704 17:61007698-61007720 TTTTTTTTTTTTAAACAGGATGG - Intronic
1150058118 17:62038366-62038388 TTTTTTGTTTGGAGACTGGAGGG - Intronic
1150380269 17:64714574-64714596 TTTTTTTTTTTTGAGATGGATGG - Intergenic
1150422194 17:65047662-65047684 TTTTTTTTTTTTAAGAGGGAGGG + Intronic
1150622007 17:66814681-66814703 TTTTTTTTTTTGGAGCTGTCTGG + Intergenic
1151005341 17:70429677-70429699 TTTTTTCTTTTTGAGATGGATGG + Intergenic
1151285231 17:73106069-73106091 TTTTTTTTTTTTAAGTGGGATGG + Intergenic
1151632975 17:75323812-75323834 TTTTTTTTTTTAAAGATGGATGG + Intronic
1152473881 17:80504970-80504992 TTTTTGCTTTGGAAGATGTAGGG + Intergenic
1152576817 17:81144835-81144857 TTGTAGCTTTTGACGCTGGAAGG - Intronic
1152857232 17:82672424-82672446 TTGTTGCTTTTTAAGCTAGATGG + Intronic
1153034543 18:748364-748386 TTTTTTTTTTTAAAGCTTTAAGG + Intronic
1153276414 18:3372172-3372194 TTTTTTTTTTTAGAGATGGAAGG + Intergenic
1153329326 18:3856854-3856876 TTTTTTTTTTTGGAGGGGGACGG - Intronic
1153387907 18:4520073-4520095 TTTTTGCTGTTGATTCTGGAGGG - Intergenic
1154127277 18:11702809-11702831 TTTTTTTTTTTTAAGTGGGAAGG - Intronic
1154463720 18:14622462-14622484 TTTTTTTTTTTCAAGCTGACTGG + Intergenic
1154952543 18:21224402-21224424 TTTTTTTTTTTGCTGGTGGAGGG + Intergenic
1155004958 18:21720495-21720517 TTTTTTTTTTAGAAAGTGGAAGG + Intronic
1155082588 18:22425556-22425578 TTTTTTTTTTTTAAGAGGGAGGG + Intergenic
1155164882 18:23224068-23224090 TATAGTCTTTTAAAGCTGGAAGG + Intronic
1155167811 18:23245492-23245514 TTTTTTTTTTTGAGACAGGATGG - Intronic
1155649473 18:28123592-28123614 TTTTTTCTTATGAGCCAGGATGG - Intronic
1155930806 18:31706128-31706150 TTTTTTCTTATAATGTTGGAGGG - Intergenic
1156011432 18:32501613-32501635 ACTTTTCTTTTGCAGCTGGGAGG - Intergenic
1156493669 18:37511767-37511789 TTCTTTTTTGTAAAGCTGGAGGG + Intronic
1156509488 18:37624580-37624602 TTTTTTCTTTGGTAACTAGAAGG + Intergenic
1156705596 18:39877761-39877783 TTTTTTCTTTTTTAGCTTGTAGG - Intergenic
1157049350 18:44142923-44142945 TTTATTATTTTGAAGCTGAAAGG + Intergenic
1157733351 18:50023910-50023932 TTTTTCTTTCTGAAGTTGGAAGG - Intronic
1157929174 18:51801938-51801960 TTTTTTTTTTTGAAGGTGTGGGG + Intergenic
1158304630 18:56091322-56091344 TTTTTTTTTTTTAATTTGGAAGG + Intergenic
1158404656 18:57150824-57150846 TGTTTCCTTTTTAAGCTGCAGGG + Intergenic
1158617267 18:58999833-58999855 GTTTTACTTTTTAAGCTGGGTGG + Intergenic
1158767929 18:60478052-60478074 GTTGGTTTTTTGAAGCTGGAAGG + Intergenic
1159587852 18:70299112-70299134 TTTTTTGTTTTTAAGACGGAGGG - Intronic
1159591561 18:70340848-70340870 CTTTTTCCTTTGAACTTGGATGG + Intronic
1159603452 18:70450877-70450899 TTTTTTTTTTTAAAGCAAGAGGG + Intergenic
1160050366 18:75427700-75427722 TATTATTTTATGAAGCTGGATGG + Exonic
1160281728 18:77497594-77497616 TTTTTTTTTTTAAAGCAGAAAGG + Intergenic
1160622173 18:80179229-80179251 TTTTTTTTTTTCAAACTGGAGGG + Intronic
1161157991 19:2744173-2744195 TTTTTTCTTTTGAAGAGACAGGG - Intergenic
1161483076 19:4520368-4520390 TTTGTTCTTTTGAGGCGGGGTGG - Intergenic
1161603740 19:5202685-5202707 TTTTTTATTTTGAGGTAGGAGGG - Intronic
1162113256 19:8412971-8412993 TTTTTTTTTTTGAGACTGGCCGG - Intronic
1162875175 19:13616149-13616171 TTTTTTCTTCACCAGCTGGACGG + Intronic
1163216469 19:15881790-15881812 TTTTTTTTTTTAAGGCTGAATGG - Intronic
1163985631 19:20946046-20946068 TTTTTTTTTTTGAAGATTGTTGG + Intronic
1164103753 19:22084441-22084463 TTTTTTTTTTTGAAGATTGTTGG + Intronic
1164104801 19:22100130-22100152 TTTTTTCTTTTGATGTTGAGAGG - Intergenic
1164734567 19:30531448-30531470 TTTTTTTTTTTGAAGATTCAGGG + Intronic
1164969420 19:32518550-32518572 TTTTTTCTTTTGAGGAGGGAGGG - Intergenic
1166170803 19:41026572-41026594 TTTTTACGCTTGAACCTGGAAGG - Intergenic
1166293155 19:41876236-41876258 TTTTTTTTTTTTAAGAGGGATGG - Intergenic
1166443864 19:42841213-42841235 TTTTTTTTTTTGAAGAGAGAGGG - Intronic
1166630977 19:44407673-44407695 TTTTTTCTGTCCAAGCTGGGAGG - Intergenic
1167658736 19:50783336-50783358 TTTTTTTTTTTAAGCCTGGAGGG + Intergenic
1168566994 19:57433623-57433645 TTTTTTTTTTTTAAACTGGTTGG + Intronic
925125472 2:1452527-1452549 TTTTTACCTTTGCAGATGGAAGG + Intronic
926078034 2:9958181-9958203 TTTTTTTTTTTGAGTCAGGAAGG + Intronic
926807661 2:16726154-16726176 TTTCTTCTGTTGGAGCTGGGTGG + Intergenic
926892931 2:17653613-17653635 TATTTACTTTTGTAGCTAGATGG - Intronic
927160443 2:20253515-20253537 TTTTTTTTTTTGTAGAGGGAGGG + Intronic
927526301 2:23744287-23744309 TTTTTTTTTTTGGAGAAGGAGGG + Intergenic
928261896 2:29775526-29775548 TTTTTTTTTTTGTAGGGGGAGGG - Intronic
928357521 2:30632980-30633002 CCTTTTATTTTGAAGCTGAAAGG + Intronic
929147681 2:38720965-38720987 TTTCCTCTTTTGAACTTGGATGG - Intronic
929559955 2:42950162-42950184 TTTTGTCTGTGGATGCTGGAGGG - Intergenic
929603996 2:43223066-43223088 TTTTTTTCTTTGAAGTTGGATGG + Exonic
929748226 2:44681545-44681567 TTTTTTTTTTTGGAGGGGGAGGG + Intronic
929808344 2:45168637-45168659 TTTTTTTTTTTGGACCTGGCCGG - Intergenic
929848623 2:45559271-45559293 TTTTTTCTTTTAAGGATGGTGGG - Intronic
930132443 2:47866234-47866256 TTTTTTTTTTTGAAGCAGAAGGG - Intronic
930808315 2:55515098-55515120 TTTTTTCTTTTGCAGAGGCAGGG + Intergenic
930881745 2:56278277-56278299 TTTTTTCTTTTAAGTCTGAATGG + Intronic
931383875 2:61778926-61778948 TTTTTTTTTTTGTAGAGGGAGGG + Intergenic
931484983 2:62681673-62681695 TTTTTAGTTTTGCACCTGGAAGG + Intronic
931525270 2:63145682-63145704 CCTTTTCTTTTGCAGCTGGGAGG - Intronic
931938971 2:67231056-67231078 TTTTTGCTTTTGCTGGTGGAAGG + Intergenic
932050837 2:68396137-68396159 TTTTTTTTTTTTAAGCTAGGGGG - Exonic
932146477 2:69323503-69323525 TTTTTTGTTTTGAGTCAGGAGGG + Exonic
932237328 2:70131081-70131103 TTTTTACTTTTGAAGAGGTAGGG + Intergenic
932270328 2:70403510-70403532 CCTTTTCTTCTGCAGCTGGAAGG + Intergenic
932289395 2:70562866-70562888 TTTTTTTTTTTTGAGATGGAGGG - Intergenic
932322150 2:70830235-70830257 TTTATTCTGAGGAAGCTGGAAGG + Exonic
932364179 2:71136855-71136877 TTTTTTTTTTTGAAACTGTTAGG + Intronic
932702960 2:74003367-74003389 TTTTTGCTTTCTCAGCTGGATGG + Intronic
933607141 2:84395163-84395185 CTTTATCTATTGAAGCAGGATGG - Intergenic
933607406 2:84397978-84398000 GATTTTCTTTTGAAGATGAAAGG - Intergenic
934325596 2:92011482-92011504 AATTTCCTTTGGAAGCTGGATGG - Intergenic
934748922 2:96779262-96779284 TTCTTTCTTTAAAAGCTGTATGG + Intronic
935032942 2:99339546-99339568 TTTTGTTTTTTGGAGATGGAGGG + Intronic
935366856 2:102302769-102302791 TTTTTACTTATGAAGCTTGGAGG - Intergenic
935447110 2:103168319-103168341 ATTTTTTTTTTAAATCTGGAGGG + Intergenic
935590069 2:104838885-104838907 TTTTTTTTTTAGCAGCTAGAAGG + Intergenic
936414343 2:112290654-112290676 TTTTTTTTTTTTTAGCTGGAAGG + Intronic
936549228 2:113420985-113421007 TTTTCTCTTTTGAATGTGGTAGG - Intergenic
936600368 2:113889744-113889766 GTTCTGCTTCTGAAGCTGGAAGG - Intergenic
936636671 2:114266688-114266710 TTATTTCTTTTTAAGCTAAAAGG - Intergenic
936670944 2:114655220-114655242 TATTGACTTTTGAAACTGGAGGG + Intronic
936768806 2:115886892-115886914 TTTTTTCTTTTGAAGATAACAGG - Intergenic
936855390 2:116952088-116952110 CTTTTTCTTCTTAAGATGGATGG + Intergenic
936914156 2:117623159-117623181 TATTTTCGTTTTAACCTGGATGG + Intergenic
938443264 2:131354381-131354403 TTTTTTTTTTTTGAGATGGATGG + Intergenic
938598318 2:132811695-132811717 TTTTTTCTTTCTCAGCTGGGTGG - Intronic
938642152 2:133292294-133292316 TTTTTTTTTTTAAATCTAGAAGG - Intronic
939346389 2:140971104-140971126 TTTTTTCTTTTGAAGGATGTTGG - Intronic
939373447 2:141332621-141332643 TTTTTTTTCTTGAAAATGGATGG + Intronic
939400508 2:141686588-141686610 TGTTTCCTTCTGAATCTGGAGGG + Intronic
939402678 2:141714924-141714946 TTTTTTCTATTCAAGCTTGTTGG - Intronic
939559096 2:143712792-143712814 TTTTTTTTTTTAAAGCTGAAGGG - Intronic
939873864 2:147554668-147554690 TTTTTTCTTTTGACTCAAGAAGG - Intergenic
940246498 2:151623746-151623768 ATGTTTCTTTTGAAACTGGAAGG + Intronic
940431302 2:153593140-153593162 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
940518407 2:154711879-154711901 TTATTTCTTTTTAGGCAGGAGGG - Intronic
940848728 2:158668174-158668196 TTTTTTTTTTTTAACCTGGCTGG + Intronic
941083975 2:161094846-161094868 TTTTTTTTTTTAATGCAGGAAGG + Intergenic
941258230 2:163261297-163261319 TTGTTGCTTTTGAGGCTGGGAGG + Intergenic
941295512 2:163734546-163734568 TTTTTTTTTTTGAAGGAGGGAGG - Intronic
941413453 2:165188793-165188815 TTTTTTTTTTTGAAGTGGGGCGG - Intronic
941421986 2:165294043-165294065 TTTTTTTTTTTAAAGCATGATGG + Intronic
941680320 2:168391359-168391381 TTTTTTTTTTTAAAGCAGGAAGG + Intergenic
942631298 2:177952428-177952450 TTTTCTCTTGTGAATCTTGAGGG + Intronic
942841165 2:180362762-180362784 TTTTTACTTTTGAAGATGTCAGG + Intergenic
942893009 2:181015098-181015120 TTTTTCCCTTTTAAGATGGAAGG + Intronic
942956392 2:181779135-181779157 TTTTTTTTTTTTAAGCAAGAAGG - Intergenic
943112169 2:183620391-183620413 TTTTTTCATTTCAACCTTGATGG + Intergenic
943382252 2:187165722-187165744 ATTTTTCTTTTGACTCTGGTAGG + Intergenic
943621199 2:190150142-190150164 TCTTTTCTTTTGCAGCTGGGAGG - Intronic
943668990 2:190640820-190640842 TTTTTTTTTTTTTAGCTAGATGG + Intergenic
943956535 2:194199117-194199139 TTGCTTATTTTGAAGATGGAAGG + Intergenic
944068080 2:195640324-195640346 TTTTTTCTTTTAATGCTTCAGGG - Intronic
944225176 2:197342377-197342399 TTTTTTTTTTTGGAGATGGGGGG - Intergenic
944282648 2:197915526-197915548 TTTTTTTTTTTGAAGTCCGATGG + Intronic
944544488 2:200785497-200785519 TTGATTCTTCTGAAGCTGCAGGG - Intergenic
944640252 2:201717467-201717489 TTTTTTTTTTTGGAGGTGGGAGG - Intronic
944657707 2:201892407-201892429 TATTTTCTTAAGCAGCTGGAAGG + Intronic
944944594 2:204668929-204668951 TTTATGGTTTTGAAGTTGGAAGG + Intronic
945247855 2:207736726-207736748 TTTTTGCTTTTTAAGCTGTTAGG - Intronic
946012675 2:216578906-216578928 TTTTTCCTTTTGCAGCAGAATGG + Intronic
946283929 2:218688376-218688398 TTTTTTGTTTTTAAGGTGAAGGG + Intronic
946720225 2:222597870-222597892 TTTCTTCTTTTAAAGCAGGTAGG - Intronic
946917835 2:224543977-224543999 TTTTTTTTTTTGAAATGGGAGGG - Intronic
946971781 2:225101440-225101462 TTTTTTCTTTTTAAACTGGGAGG + Intergenic
947118082 2:226792147-226792169 TTTTTTCTTTTAAAGGGGGAGGG + Intronic
947210298 2:227702400-227702422 TTTTTTTTTTTTGAGATGGAGGG + Intronic
947457130 2:230265376-230265398 CTTTTTCTTCTGCAGCTGGGAGG - Intronic
947571842 2:231242155-231242177 TTTTTTTTTTTTAAACTGGATGG + Intronic
947869225 2:233423683-233423705 TTTTTTCTTGTGGCGCTGGCTGG + Intronic
947968070 2:234299022-234299044 TTTCTTCATTTGTAGCTGGATGG - Intergenic
948202163 2:236136983-236137005 TGTTTATTTTTAAAGCTGGAGGG + Intergenic
948418002 2:237830910-237830932 TTTTTTTTTTTGTAGATAGACGG - Intronic
948535774 2:238645521-238645543 TTTTTTTTTTTGCAACTAGATGG - Intergenic
948841109 2:240649496-240649518 TTGGTCCTATTGAAGCTGGACGG - Intergenic
1168756143 20:319235-319257 TTTTTTTTTTTGAGACGGGACGG - Intergenic
1169330042 20:4709174-4709196 TTTTTTTTTTGGAAGCAGGGAGG - Intergenic
1169401279 20:5282705-5282727 TCTTTTCTTTTGCAGCTGGGAGG + Intergenic
1169601428 20:7265333-7265355 TTTCTCCTTTTGAAGCTTAAGGG + Intergenic
1169891685 20:10460385-10460407 TTTTTCCTTTTGATGTTGGTTGG + Intronic
1169906377 20:10608820-10608842 TTTTCTCCTTTCAAGCAGGAAGG - Intronic
1170001114 20:11615473-11615495 TTTTTTTTTTTTGAGCCGGAAGG + Intergenic
1170130064 20:13009737-13009759 CTTTTTCTTCTGAAGCATGACGG - Intronic
1170136567 20:13080500-13080522 GTTTTTTTTTTGGAGATGGATGG - Intronic
1170319571 20:15080090-15080112 TGTTCTGTTTTGAAGATGGAAGG - Intronic
1170941841 20:20854495-20854517 TTTTTTCTTTTGTAATGGGACGG + Intergenic
1171076848 20:22135955-22135977 TTTTTTTTTTTAAAGCAGGCAGG + Intergenic
1171948788 20:31402419-31402441 TTTTTTTTTTTTAATCTGGGAGG + Intergenic
1172080577 20:32337690-32337712 TTTTTTTTTTTTAAGATGGATGG - Intergenic
1172292476 20:33786041-33786063 TTTTTTTTTTTGAGACTGAATGG + Intronic
1172559556 20:35874925-35874947 TTTTATTTTTTGAAGAGGGAGGG - Intronic
1172679536 20:36701852-36701874 TTTTTTTTTTTAAAGATGCAGGG - Intronic
1173080949 20:39866929-39866951 TTTTTTTTTTTGAAACCTGATGG - Intergenic
1173096877 20:40041788-40041810 TTTTTTTTTTTGCATTTGGATGG + Intergenic
1173336693 20:42117813-42117835 TCCTTTCTTTTTAAGATGGAAGG + Intronic
1173939372 20:46896392-46896414 TTTTTTTTTTGTAAGCAGGATGG - Intronic
1174016337 20:47491361-47491383 TTTTTTTTTTTTAAGATGGCCGG + Intergenic
1174024445 20:47561305-47561327 TTTTTTTTTTTAAAGCTACACGG + Intronic
1174240778 20:49132950-49132972 TCCTTTCTTTTGCCGCTGGAAGG - Intronic
1174302031 20:49589490-49589512 TATTTTTTTTTTAAGATGGATGG + Intergenic
1174680532 20:52402407-52402429 TTTTTTCTTTTTTTGGTGGAGGG + Intergenic
1174778362 20:53366052-53366074 CTTTTTCTTCTGACACTGGAAGG - Intronic
1174948784 20:55020046-55020068 TTTTTCATTTTGAGGATGGAAGG - Intergenic
1175001141 20:55631972-55631994 TTTTTTTTTTTTAAGATGCAGGG + Intergenic
1175570670 20:60018726-60018748 TTTTTTTTTTTGCAGTTGGGTGG + Intronic
1176417515 21:6486061-6486083 TTTTTTTTTTGGAAGGGGGAGGG + Intergenic
1176595017 21:8685276-8685298 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1176810808 21:13535912-13535934 TTTTTTTTTTTCAAGCTGACTGG - Intergenic
1176924423 21:14730229-14730251 TTTTTTCATTTGAATCTGTTGGG - Intergenic
1177207339 21:18025015-18025037 TTTGTTCTTTTGGTTCTGGAAGG - Intronic
1177461070 21:21411335-21411357 TTTTTTCTTTTCAGTCTGGCAGG + Intronic
1177467849 21:21512534-21512556 TTTGTTCTTTTGAGTCAGGATGG + Intronic
1177543874 21:22531603-22531625 TTTTGCCTTTTGAAGTTGTAAGG - Intergenic
1177578787 21:22993371-22993393 TTTCTTCATTTGGAGCTGGGTGG - Intergenic
1177672413 21:24249665-24249687 TTTTTTTTTTTTAATTTGGAAGG + Intergenic
1177872843 21:26594163-26594185 TTTTTTATTGTGAGGCAGGAGGG - Intergenic
1177903899 21:26951669-26951691 TTTTTTTTTTTTGAGATGGAGGG - Intronic
1178293247 21:31387210-31387232 TTTTTTTTTTTGGAGGTGGGGGG + Intronic
1178613292 21:34106928-34106950 TTTTTTTTTTTGGCGGTGGAGGG + Intronic
1179693011 21:43094394-43094416 TTTTTTTTTTGGAAGGGGGAGGG + Intronic
1180085873 21:45507604-45507626 TTTTTTCTGTTGAGACTGGTGGG + Intronic
1180277870 22:10662434-10662456 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1180552611 22:16552727-16552749 GTTTTTCTGGTAAAGCTGGAAGG - Intergenic
1180585103 22:16881267-16881289 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1180715993 22:17872780-17872802 TTCTTTCCTTTGAAGCTGATTGG + Intronic
1181521610 22:23451728-23451750 TTTTTTGTCTTGAGGCTGTAAGG - Intergenic
1181759365 22:25047475-25047497 TTTTTTTTTTTTGAGATGGATGG + Intronic
1181881500 22:25983949-25983971 CTTGTTTTGTTGAAGCTGGAAGG - Intronic
1183067070 22:35370609-35370631 TTTTTTCTTTTGGAGAAAGAAGG - Intergenic
1184434800 22:44464621-44464643 TTTTTTTTTTGGTAGCTGTACGG + Intergenic
1185007034 22:48285634-48285656 TTTTTTTTTTTGCATGTGGATGG - Intergenic
949135573 3:560998-561020 ATGGTTCTTATGAAGCTGGAAGG + Intergenic
949349680 3:3112795-3112817 TTTTTTCTTTTGAGACAGGGTGG + Intronic
949366387 3:3286093-3286115 TTTTTTTTTTTGAAGCTGAAGGG - Intergenic
949393082 3:3584509-3584531 TGTTTTGTTTTGTGGCTGGATGG - Intergenic
949418405 3:3837730-3837752 TTTTTTTTTTTAAAGCTCCAGGG + Intronic
949520675 3:4850984-4851006 TTTTTTCTCTCCAAGCTGGGTGG - Intronic
949523426 3:4878586-4878608 TTTTTTCTTTTTAGGTTAGATGG + Intronic
949671737 3:6404018-6404040 TTTTTTTTTTTTGAGATGGATGG - Intergenic
949767830 3:7546986-7547008 TCTTTTGTTTTGAAGCAGGGAGG + Intronic
950206627 3:11085780-11085802 TTTTTTTTTTTAAAGCTGGAGGG - Intergenic
950813575 3:15674163-15674185 TTTTTTTTTTTGAAGAGGCAGGG - Intronic
950876745 3:16282357-16282379 TTTTTTTTTTTTAAGCTGGGTGG - Intronic
951145330 3:19219890-19219912 TTTTTGCTTTTGATGCTAGTAGG - Intronic
951158922 3:19391676-19391698 CTTTTTCTTTTTAAGTTGGGAGG + Intronic
951269561 3:20608078-20608100 CGTTTTCTTTTGAAGCTGGGAGG + Intergenic
951723596 3:25729408-25729430 TTTTTTCTTTTCAATTTTGAAGG - Intronic
952338408 3:32424641-32424663 TTTTTTTTTTTGCGGCTGGGGGG + Intronic
952567557 3:34677524-34677546 TTTTTTCTTTTGGGGGAGGAGGG + Intergenic
952690125 3:36195702-36195724 TTTTTTCCTTGGCAGCTGTAAGG + Intergenic
952704947 3:36367901-36367923 TTTTTTGTTTTTGAGGTGGAGGG - Intergenic
952708981 3:36409948-36409970 TATTTTCTTTTAAAGGTGTATGG + Intronic
954341425 3:49956987-49957009 TTTTTTCTTTTTAAGAGGGAGGG + Intronic
954527904 3:51289460-51289482 TTTCTTCCTTTGTGGCTGGATGG - Intronic
955212831 3:56958180-56958202 TGTTTTCTTTGGAACCTGGAGGG - Intronic
955416272 3:58694986-58695008 TTTTTTCTTTTGCAGCTGTGAGG + Intergenic
955461669 3:59189930-59189952 CTTTTTCTTTTGCAGCTGGGAGG - Intergenic
955694794 3:61624950-61624972 TAATTCCTTCTGAAGCTGGAAGG + Intronic
955989844 3:64614864-64614886 TTTTTTTTCTTGCAGTTGGATGG + Intronic
956143850 3:66172657-66172679 TGGTTTCTTTTGAAGCTGTGAGG + Intronic
956188953 3:66590045-66590067 TTTTGTCTTTTGTAGCAAGATGG - Intergenic
956365676 3:68499870-68499892 TTTTTTTTTAAGAAGCAGGAAGG + Intronic
956439495 3:69266022-69266044 TTTTTTTTTTTGTAGCAAGAGGG - Intronic
956443295 3:69301119-69301141 TTTTTTCTTTGCAACCTGGGTGG - Intronic
956450850 3:69373152-69373174 TTTCTTCTTTTGAAGTGGAAAGG + Intronic
956547347 3:70419203-70419225 TTTTTTCTTTTGAAGAGATAGGG + Intergenic
956585195 3:70856658-70856680 TTTTTTTTTTTGCAGGGGGACGG + Intergenic
956593160 3:70937561-70937583 TTTATTTTTTTGATGCTGGGTGG + Intergenic
956648073 3:71476420-71476442 TTCTTTCATTTGATGGTGGATGG + Intronic
956679315 3:71763200-71763222 TTTTTTGGTTTGAACCTGGAGGG + Intergenic
956758715 3:72417189-72417211 TTTTTTCTTTTCAGTCTGTATGG - Intronic
956769820 3:72515667-72515689 TTTTTAATGATGAAGCTGGAAGG - Intergenic
956772090 3:72535248-72535270 TTTTTTTTTTTTGAGATGGAGGG + Intergenic
957188012 3:76967715-76967737 TTTTTGTTTTTGGAGATGGAGGG + Intronic
957585054 3:82122407-82122429 TTTTTTCTTCTATAGCTAGAGGG + Intergenic
957588848 3:82169498-82169520 TTTTTTTTTTTAAGGCTGAATGG - Intergenic
958480830 3:94643675-94643697 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
958565259 3:95801898-95801920 TTTTATCTTTTGGAGCTGCATGG + Intergenic
958881154 3:99671954-99671976 TTTTTTCTCTTGTAGCAGGTTGG - Intronic
958928685 3:100186465-100186487 TTTTTTTTTTTTATGCTGGCAGG + Intronic
959099810 3:101997466-101997488 TTTTTGACTTTGAAGATGGAGGG + Intergenic
959480893 3:106871687-106871709 TTTTTTTTTTTTGAGATGGATGG + Intergenic
959536298 3:107489203-107489225 TTTTTTCTTTTGTAGAGAGAGGG + Intergenic
959845264 3:111025171-111025193 TTTTTTTTTTTGGAGATAGATGG + Intergenic
959997220 3:112693193-112693215 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
960115680 3:113889943-113889965 TTTCTTTCTTTGAAGCTGGCAGG + Intronic
960163916 3:114380490-114380512 TTTTTTTTTCTGAAGGGGGATGG + Intronic
960351535 3:116599398-116599420 TTTTTTCTTGTAAATCAGGAAGG - Intronic
960534922 3:118804992-118805014 ATTTGTGTTTTGAAGTTGGAAGG + Intergenic
961069976 3:123914390-123914412 GTTTTTCTGTTGAAACTAGAGGG - Exonic
961165944 3:124763962-124763984 TGGTTTCTGTTAAAGCTGGAAGG - Intronic
961479242 3:127169049-127169071 TTTTAACTGTTGAAGCTGGGGGG + Intergenic
962216316 3:133525044-133525066 ATTTTTCTTTTTAAGATGGTTGG + Intergenic
962563912 3:136637877-136637899 TTTTTTTTTTTTAAGATGGGAGG + Intronic
963029913 3:140959533-140959555 TTTTTTTTTTTTTACCTGGAAGG - Exonic
963126497 3:141821501-141821523 TTTTTTTTTTTGCAGTTGCAAGG - Intergenic
963364518 3:144318042-144318064 TTTTTTCTTATCAAGCTGTAAGG + Intergenic
963710025 3:148737009-148737031 CTTTTTTCTTTGAAGCTGAACGG - Intronic
964188945 3:153980144-153980166 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
964229778 3:154452302-154452324 TTTTTTTTTTTTGAGATGGATGG + Intergenic
964643774 3:158936702-158936724 CCTTTTCTTTCGCAGCTGGAAGG + Intergenic
964721715 3:159773528-159773550 TTTTTTCTTTTAAAAATGAATGG + Intronic
964835499 3:160934001-160934023 TTGTTTCTTTTAAAGCTAGAGGG + Intronic
964995483 3:162873191-162873213 TTTTTTTTTTTAAAGGTGGTAGG + Intergenic
965068951 3:163891959-163891981 TTTTTGGTTTTGACGATGGAGGG + Intergenic
965071604 3:163922863-163922885 TTTTTTTTTTTGGAGTTAGAAGG + Intergenic
965119346 3:164531522-164531544 GTTTTGCTATTGAAGTTGGATGG + Intergenic
965216926 3:165875118-165875140 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
965234204 3:166094038-166094060 TTCTTTCTTTTAAATCTGCAAGG - Intergenic
965321944 3:167261764-167261786 TTTTTTTTTTTGCAGTTGGGAGG - Intronic
965357036 3:167688444-167688466 TTTTTTCTTTAGAAAGGGGAGGG - Intronic
965777706 3:172250050-172250072 TTTTTTCTTATAAAGATGTAAGG + Intronic
965874429 3:173299710-173299732 TATTTGCTTTTGCAGCTGGGAGG - Intergenic
965942700 3:174204137-174204159 CTTTTTCTTTTGGAGCAGTAGGG + Intronic
965946352 3:174246744-174246766 TTTTTTTTTTTGAAGCTTAGAGG + Intronic
965991745 3:174827438-174827460 TTGTTTGTTTTGAAGATGGAGGG - Intronic
966020474 3:175203053-175203075 CTTTTTCTTTTGCAGCTAGGAGG - Intronic
966133329 3:176669572-176669594 CTTTTTTTTTTAAAGCTGTATGG - Intergenic
966306270 3:178538781-178538803 TTTTTTCTTTATAAGCTGTGAGG + Intronic
966310108 3:178584435-178584457 CTTTTTCTTTTGGAGAGGGAGGG - Intronic
966448715 3:180033253-180033275 TTATGTCTTGTGAAGCTAGAGGG + Intronic
967591227 3:191276064-191276086 TTTTGTCTTTTCTAGCTGGAAGG + Intronic
967598314 3:191354238-191354260 TTTTTGCTTTTGAAGCAGAATGG + Intronic
967673907 3:192272899-192272921 TTTTTTCTTCTGAAACTGGAAGG - Intronic
967780443 3:193433378-193433400 TTTATTCATTAGAAGGTGGAGGG + Intronic
968059754 3:195718423-195718445 TTTCCTCTTTTGCAGCTGCAAGG - Intergenic
968258913 3:197303051-197303073 TTTTTTTTTTTTAATCAGGAAGG + Intergenic
968321883 3:197776908-197776930 TTATTTTTTTTGAAACTAGATGG + Exonic
969727206 4:8927484-8927506 TTTCCTCTTTTGCAGCTGCAAGG - Intergenic
970073027 4:12183880-12183902 TTTTTTTTTTTGTAGAGGGACGG - Intergenic
970157456 4:13155342-13155364 TTTTTTTTTTTGAAAGTAGAAGG - Intergenic
970230743 4:13908238-13908260 TTTTTTCTTTTCATGGTGGATGG + Intergenic
970285418 4:14507869-14507891 TTTTTTTTTTTGTAGATGCAAGG + Intergenic
970388159 4:15577715-15577737 TTTTTTTTTTTTAACTTGGAAGG + Intronic
970756322 4:19430864-19430886 TTTTTACTTGTTAAGATGGAGGG - Intergenic
971842211 4:31868182-31868204 TTTATTGTTTTGAAGCAGGCAGG + Intergenic
972831784 4:42822288-42822310 TTTTTTCTTTTCATGATGGCCGG - Intergenic
973575624 4:52285713-52285735 TTTTTTCTTTTCATGAGGGAGGG - Intergenic
973840779 4:54858267-54858289 GTTTCTCTTTTGAAGTTGGGAGG - Intergenic
973897752 4:55432482-55432504 TTTTTTTTTTTAAAGCTGGAAGG + Exonic
974247276 4:59336101-59336123 TTTTTTTTTTTGGAGTGGGACGG + Intergenic
974353390 4:60779589-60779611 TTTTTTCTACTGAAGCTAGAAGG - Intergenic
974855954 4:67460648-67460670 TTTTTTTTTTTTGAGATGGATGG - Intergenic
975280354 4:72555165-72555187 TTTCTACTTTTGAAGTGGGAGGG - Intronic
975374070 4:73621827-73621849 TTTTTTTTTTTGAATCAGGCTGG - Intergenic
975408469 4:74020007-74020029 TTTTTTCTTCTGAAAATGTATGG + Intergenic
975517215 4:75260055-75260077 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
975664977 4:76726532-76726554 TTTTTTTTTTTTTAGATGGAGGG - Intronic
975896792 4:79102507-79102529 TTTTTTTTTTTTAAGTTGGTGGG + Intergenic
975956092 4:79840244-79840266 TTTTTTCTTTTCAATCTAGATGG + Intergenic
976309675 4:83598626-83598648 TTTTTTTTTTTAAACCAGGAAGG + Exonic
976500963 4:85788458-85788480 TTTATTTTTTTGAAGCTGGAGGG + Intronic
977102705 4:92837467-92837489 TTTTTTTTTTTTAACCTGAAGGG - Intronic
977434769 4:96979697-96979719 TTATTTCTTTTTAATCTGTATGG - Intergenic
977692595 4:99931965-99931987 TTTATTCTTTTGCATGTGGATGG - Intronic
977786648 4:101042812-101042834 TTTTTTTTTTTAAAGTGGGATGG + Intronic
978104811 4:104889188-104889210 TTTTTTCTTTTGAGGAGGGGAGG - Intergenic
978778550 4:112525911-112525933 TTTTTTTTTTTTAATCTGGCTGG - Intergenic
978820661 4:112961064-112961086 TTTTTTTTTTTGAAACTGGTGGG + Intronic
979295153 4:119023606-119023628 TATTTTCTCTTGAAGCTACATGG + Intronic
979492692 4:121346793-121346815 TTTTTTCTTCTTTAGCTTGATGG + Intronic
979646139 4:123071474-123071496 TTTTTTTTTTTGGAGGGGGACGG - Intronic
979681140 4:123461341-123461363 TTTTTTTTTTTGAGGCAGGCTGG + Intergenic
979973949 4:127172717-127172739 TTTTTTTTTTTGCTGGTGGAGGG - Intergenic
980237778 4:130131388-130131410 TATTTGCTTTTGCAGCTGGGAGG + Intergenic
980412725 4:132444949-132444971 TTTTTTCTTTTAAAGCTAAGTGG + Intronic
980523486 4:133960633-133960655 TCTTTTCTTTTGCAGCTGGGAGG + Intergenic
980537308 4:134144569-134144591 TTTTTTTTTTTTAACCTGGTAGG - Intergenic
980773351 4:137407655-137407677 TATTTTCTTCTGAAAATGGAGGG - Intergenic
980897034 4:138869642-138869664 TTTTTTTTTTTGAAATTGTAAGG + Intergenic
981245530 4:142532580-142532602 CCTTCTCTTTTGAAGCTTGAAGG - Intronic
981817612 4:148849131-148849153 ATTTTTCTTTTGGTGATGGAGGG + Intergenic
982030981 4:151300608-151300630 TTTTTTTTTTTTAAGGTGTATGG + Intronic
982189982 4:152843842-152843864 CCTTTTCTTTCGCAGCTGGAAGG - Intronic
982218813 4:153107347-153107369 CTTTTTCTTTTGCAGCCGGGAGG - Intergenic
982675682 4:158373140-158373162 TATTTAGTTTTCAAGCTGGATGG + Intronic
982903211 4:161034079-161034101 GTATTTCATTTGAAGCTGAAAGG - Intergenic
983087943 4:163470275-163470297 TTATATTTTTTGTAGCTGGAGGG - Intergenic
983365272 4:166778727-166778749 TTTTTTTTTCTAAAGCAGGAAGG + Intronic
983479669 4:168257302-168257324 TTTTTTTTTTTGAAGGGCGATGG - Intronic
983539874 4:168897866-168897888 TTTTTTCTTCTAAAGATGGTGGG + Intronic
983658263 4:170105466-170105488 TTTTTTCTTTCTAATTTGGATGG - Intergenic
983679438 4:170335147-170335169 TTTTTTTTTTTCGAGATGGAGGG - Intergenic
983699672 4:170576861-170576883 TTTTTACTTTTGAAGATGAAAGG - Intergenic
983913260 4:173264139-173264161 ATTTTTCTTTTGAAAAGGGAAGG - Intronic
983916205 4:173294276-173294298 TTTTTTTTTTTTAAGTTGAAGGG + Intronic
983994732 4:174168228-174168250 TTTTTTGTTCTGCAGTTGGAAGG - Intergenic
984078546 4:175214336-175214358 TTCTTTCTTTTGCAGCTGTATGG + Intergenic
984409603 4:179379448-179379470 TTTTTTCTTTTCATGCTGTTGGG + Intergenic
984839633 4:184056496-184056518 TTTTTTTTTTTGATGATGGTTGG - Intergenic
984934257 4:184876431-184876453 CTTTTTCTCTTGCAGCTGCATGG - Intergenic
985431361 4:189883981-189884003 TTTGTTATTTTGAAGCTATATGG + Intergenic
985881798 5:2643828-2643850 TTTTTTCCTTAGAAGCTGCTAGG - Intergenic
986207787 5:5642172-5642194 TTTTTTTTTTTTAAACTGGGAGG - Intergenic
987053600 5:14169216-14169238 TTTTCTCTTTTTTAGATGGAAGG + Intronic
987161068 5:15143419-15143441 TATGTTCTTTGGAATCTGGAGGG + Intergenic
987242752 5:16017515-16017537 TTTTTTTTTTAAAGGCTGGATGG - Intergenic
987446277 5:18023312-18023334 TTTTTTTTCTTGAAAATGGATGG + Intergenic
987514393 5:18887419-18887441 TTCTTTATTTTGATGCTGCAAGG + Intergenic
987865641 5:23532928-23532950 TTTTTTCTGTAGAAGGTGGTTGG - Intergenic
988142396 5:27260640-27260662 ATATCTCTTTTGAAGCTGTAAGG - Intergenic
988248257 5:28718638-28718660 TTTTTTTTTTTTTAGCAGGATGG - Intergenic
988344553 5:30020838-30020860 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
989039762 5:37215753-37215775 TTTTTTTTTTTGAAGATAAACGG + Intronic
989108144 5:37882603-37882625 TTTTTTCTTTTGAGGAAAGAGGG + Intergenic
989253409 5:39341491-39341513 TTTTTTCTTTTCATTCAGGAAGG + Intronic
989530783 5:42505440-42505462 TTTTTTTTTTTGAACATGCATGG - Intronic
989595885 5:43155759-43155781 GTTTTTCTTTTACTGCTGGATGG + Intronic
989619247 5:43368406-43368428 CTTTTTCTCTTGAGGTTGGATGG + Intergenic
990056430 5:51585963-51585985 TTTATTCCTCTGAAGATGGAAGG - Intergenic
990153571 5:52848255-52848277 CTTTTCCTTTTGAAGCAGCAAGG + Intronic
990193471 5:53287814-53287836 TTTTTTCCTTTAAAGATAGATGG + Intergenic
990238497 5:53793700-53793722 TTGCTTCTTCTGAAGCTAGATGG - Intergenic
990660065 5:58003326-58003348 TTTTTTCTTTTTTTTCTGGAAGG + Intergenic
990752579 5:59033483-59033505 TTTTCTCTTTTTCAGCAGGAGGG - Intronic
990832171 5:59971558-59971580 TTTTGACTGTTGAAGCTGGTAGG - Intronic
990842184 5:60094604-60094626 TTTTTTTTTTTTAAGTTGGAGGG + Intronic
991130007 5:63111219-63111241 ACTTTTCTTTTTAAGATGGAAGG - Intergenic
991386906 5:66100918-66100940 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
991489728 5:67170806-67170828 TTTTTTTTTTTTAAGATGTAAGG - Intergenic
991619399 5:68529962-68529984 TTTTGTCTTTTGAAACTGGGTGG - Intergenic
991967902 5:72109225-72109247 TTTTTTTTTTTTAAGCTAAAAGG - Intronic
992064749 5:73096203-73096225 TTTTTTTTTTTGCAGTTGAAAGG - Intergenic
992102098 5:73417931-73417953 TTTTTTCTTTTCAAGCTTAAAGG + Intergenic
992174014 5:74132263-74132285 TTATTTCTTTTGTATCTGCATGG - Intergenic
992207588 5:74445911-74445933 TATTTTCTTTTGAACTTGCATGG - Intergenic
993330300 5:86591697-86591719 TTTATTCTTTTGCAGCCAGAGGG - Intergenic
993469014 5:88284039-88284061 TTTTTTCTCCTTAAACTGGATGG + Intergenic
993518215 5:88864152-88864174 TTTTTTTTTTTAAGGCTGAATGG + Intronic
993632795 5:90307238-90307260 TTTTTTCTTTTTTAGCAAGAGGG - Intergenic
993770802 5:91923832-91923854 TTTTTTTTTTTAAGGCTGAATGG - Intergenic
993846069 5:92945146-92945168 TTTTTTCTTTTTCAGGAGGAAGG - Intergenic
993917002 5:93755941-93755963 CTTTTACTTTTGCAGCTGGGAGG + Intronic
994466446 5:100139117-100139139 CTTTTTTTTTTGAAGTTAGAAGG - Intergenic
994472788 5:100230433-100230455 TTTTTTTTTTTGAAATTTGAGGG + Intergenic
994544510 5:101147495-101147517 TTTTTGTTTTTGTAGCTGTATGG + Intergenic
994563317 5:101406614-101406636 TTTTTTCCTTTAAAGCTTTAAGG - Intergenic
994689037 5:102993525-102993547 TTTCTTCTCTTGGAGTTGGAAGG + Intronic
994875261 5:105413715-105413737 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
994965294 5:106662205-106662227 TTTTTTTTTTTGTAGCGGGGAGG + Intergenic
995585807 5:113646949-113646971 TTTCTTTTTTTGAAACAGGAAGG - Intergenic
995606625 5:113863525-113863547 TATTTTCTTTTGAGGATGAAAGG + Intergenic
995813225 5:116133578-116133600 TTTTTTCTTTTTAATTTAGAGGG - Intronic
995823393 5:116264707-116264729 TTTTTTCTTTAGGAGCTTGATGG + Intronic
996606141 5:125325759-125325781 TATTTTTTTTTCAAGCAGGATGG + Intergenic
996887676 5:128377539-128377561 TTTTTTTTTTTGGTGGTGGAGGG - Intronic
996898139 5:128510530-128510552 TTTATTCTTTTCAGGCAGGAAGG + Intronic
997388160 5:133490136-133490158 TTTTTTTTTTTAAATCTGCAGGG + Intronic
997478590 5:134165028-134165050 TTTTTTTTTTTGAGGGGGGAGGG + Intronic
998222532 5:140298465-140298487 TTTTTTTTTTTTAAGTTGGGGGG - Intronic
998544499 5:143015144-143015166 TTATTTTTTTTGGAGGTGGAGGG - Intronic
998575167 5:143307436-143307458 TTTTTTCTTTTGATGAAAGAAGG + Intronic
998705428 5:144753816-144753838 ATTTTTCTTTGGAAATTGGAGGG + Intergenic
998919589 5:147053203-147053225 TTTTTTTTTTTAATGCAGGAAGG - Intronic
999796851 5:154996855-154996877 TTTTTTTTTTTGATGAGGGAGGG + Intergenic
999821716 5:155235186-155235208 TTTTTTCTTTTTGAGGGGGACGG - Intergenic
999992916 5:157065410-157065432 TTTAATCTTTTGATGCTGGAAGG - Intergenic
1000156969 5:158561831-158561853 TTTTTTCTTTTGGTGCTGTCTGG - Intergenic
1000594429 5:163197522-163197544 TTTTTCCTTTTGTAGCTACAAGG - Intergenic
1000608245 5:163347504-163347526 TTTTCTTTTTTTAAGCTGAAAGG - Intergenic
1000665391 5:163988885-163988907 ACATTTCTTTTTAAGCTGGATGG + Intergenic
1001060877 5:168487359-168487381 TTTTTTTTTTTGTAGGGGGACGG - Intronic
1001316727 5:170647563-170647585 TTTTTTTTTTTTAATGTGGATGG - Intronic
1001447250 5:171795022-171795044 TTTGTGCTTTTGAGGCAGGATGG - Intergenic
1001661722 5:173398169-173398191 TTTTTTATTTAGAGGCTGGGTGG + Intergenic
1001784137 5:174397084-174397106 TTTTTTTTTTTTAATCTGGGAGG - Intergenic
1002142957 5:177155572-177155594 TTTTTTTTTTTAAACCTGGATGG + Intronic
1002703513 5:181144097-181144119 TTTCCTCTTTTGCAGCTGCAAGG - Intergenic
1002798713 6:499862-499884 TTTTTTCTTTTTGACCTGTATGG - Intronic
1003018760 6:2491820-2491842 TTTTTTTTTTTTAATTTGGAGGG - Intergenic
1003450828 6:6230158-6230180 CCTTTTCTTTTGCAGCTGGGAGG + Intronic
1003492615 6:6636881-6636903 TTTTTTTTTTTGCAGTTCGAGGG - Intronic
1003652011 6:7969448-7969470 TTTTTGCATTTAAACCTGGAGGG - Intronic
1003668524 6:8133852-8133874 TTTTTTTTTTTTTTGCTGGATGG + Intergenic
1003670690 6:8155176-8155198 TTTTTTCTCTTGAGTCTGTATGG + Intergenic
1003843289 6:10145445-10145467 TTTTGTTTTTTTAAGCTGGGTGG + Intronic
1003871558 6:10407508-10407530 TTTTTTTTTTTACAGATGGATGG + Intronic
1003898436 6:10630533-10630555 TTTTTTTTTTTTGAGATGGAGGG + Intergenic
1004064512 6:12229832-12229854 CTCTTTTTTTTGAAGCTGGTTGG + Intergenic
1004356969 6:14938308-14938330 TTTTTTTTTTTGAGGCAGGGAGG + Intergenic
1004396031 6:15247426-15247448 TTTTTTTTTTTTAAGTTTGAGGG + Intronic
1004735476 6:18401938-18401960 TTTTTTCTTTTCATGTTAGATGG + Intronic
1005072444 6:21874386-21874408 CTTTTTCTTTTGCAGCTGGGAGG + Intergenic
1005562325 6:27053546-27053568 TTTTTTTTTTTGGAGCTTGAGGG - Intergenic
1005578558 6:27212311-27212333 TTTTTTCTTTTGAGACGGGCAGG + Intergenic
1006279217 6:33034641-33034663 TTTTTTCTTTTAAATAGGGATGG + Intergenic
1006913555 6:37579679-37579701 TTTTTTTTTTTCCAACTGGAAGG - Intergenic
1007305985 6:40905270-40905292 TTTTTTCTGTTCAAACTGGCTGG - Intergenic
1007852482 6:44817507-44817529 TTTTTTCTTTCTAATCTGTATGG - Intronic
1007868750 6:45007741-45007763 TTTTTTTTTTTGCTGCTTGATGG + Intronic
1007994725 6:46294730-46294752 GCATTTCTTTTAAAGCTGGAAGG + Intronic
1008721877 6:54364022-54364044 TTTTATCTTTAGGAGCTAGAAGG + Intronic
1008840956 6:55903851-55903873 TTTTTTTTTTTGAAATGGGAAGG - Intergenic
1009028888 6:58033404-58033426 TTTTTTCATTTGCAGCTTGAAGG + Intergenic
1009204423 6:60784778-60784800 TTTTTTCATTTGCAGCTTGAAGG + Intergenic
1009275118 6:61667137-61667159 TTTTTTTTTTTTAAGATGGAAGG + Intergenic
1009321967 6:62302768-62302790 TCTTCTCTTTTGAATCAGGAAGG + Intergenic
1009375572 6:62964204-62964226 TTTTTTTTTTTTGAGATGGATGG - Intergenic
1009451448 6:63805576-63805598 TTTTTTCTTTTGATTATGAAAGG + Intronic
1009453124 6:63824971-63824993 CCTTTTCTTTTGCAGCTGGGAGG + Intronic
1009982077 6:70738394-70738416 TTTTTTTTTCTGAATCTGGAAGG + Intronic
1010145976 6:72669917-72669939 TTTTTTTTTTGGAATGTGGATGG + Intronic
1010385538 6:75275545-75275567 TATTTTGATTTGTAGCTGGAAGG - Intronic
1010679279 6:78781026-78781048 CCTTTTCTTTAGCAGCTGGAAGG + Intergenic
1010766717 6:79783542-79783564 TATTTTCTTTTGAATGTGAAAGG + Intergenic
1011123182 6:83977439-83977461 TTTTTTTTTTTGCAGCTGCATGG + Intergenic
1011162277 6:84404472-84404494 TTTTTTTTTTTGAGGATTGAGGG - Intergenic
1011168581 6:84479227-84479249 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
1011229414 6:85143263-85143285 CTGTTTCTTTTTATGCTGGATGG - Intergenic
1011568498 6:88707385-88707407 TTTATTCTTTTGGGGGTGGAGGG + Intronic
1011789797 6:90885744-90885766 CTTTTTCTCTTGCAGCTGGGAGG - Intergenic
1011807066 6:91083874-91083896 TTTTTTTTTTTTAATATGGAAGG + Intergenic
1011939615 6:92826495-92826517 TTTCCTCTTTTGCAGCTGCAAGG - Intergenic
1012025030 6:93978633-93978655 TTTTTTTTTTTGAAGGCTGAAGG - Intergenic
1012794480 6:103742209-103742231 TTTTTTCTTTTTAATCTTTATGG - Intergenic
1012918327 6:105195172-105195194 TATTTTGTCTTGAAGATGGAAGG + Intergenic
1013173718 6:107659962-107659984 TTTTTTAATTTGTTGCTGGAAGG - Exonic
1013376443 6:109519763-109519785 TTTTTTTTTTTGAGACAGGATGG - Intronic
1013570706 6:111421616-111421638 TTTTTTTTTTTAAAGCTGATGGG + Intronic
1013597006 6:111669428-111669450 TTTTTTTTTTTTGAGATGGATGG - Intronic
1013732986 6:113191114-113191136 TATTTCCTTTTGAAGCTGTTTGG + Intergenic
1013952005 6:115794395-115794417 TTTTTTCTTTTGAAGTGGGTAGG - Intergenic
1014225991 6:118847411-118847433 TTTTTTTTTTTGAAGATTCATGG - Intronic
1014397289 6:120940808-120940830 TCCTTTCTTTTGAAGAGGGAAGG + Intergenic
1014603848 6:123448301-123448323 CCTTTTCTTTTGCAGCTGGAAGG + Intronic
1014776535 6:125517277-125517299 TTTTTTTTTTAGAGGGTGGAGGG + Intergenic
1015296465 6:131599028-131599050 TTTTTTCTTTTTAAGATTGGCGG - Intronic
1015788421 6:136941989-136942011 GTTTCTCTTTGGAAGCTGGATGG + Intergenic
1015895134 6:138009768-138009790 TTTTTTTTTTTGAGACAGGAAGG + Intergenic
1015980226 6:138831076-138831098 TTCTAACTTTTGAAACTGGATGG - Intronic
1016619328 6:146089804-146089826 TTTATTCTTTTGAGACTGAAAGG - Intronic
1016731715 6:147434579-147434601 TAATTTCTTTTAAAGATGGATGG - Intergenic
1016823827 6:148370085-148370107 TTTTCTCTTTTGTAAGTGGAAGG + Intronic
1016949346 6:149565605-149565627 TTTTTTTTTTTAAATCTGCAAGG + Intergenic
1016999141 6:149983643-149983665 TTTTTTTTTTTTGAGCTGGAAGG + Intergenic
1016999146 6:149983690-149983712 TTTCTTTTTTTTGAGCTGGAAGG + Intergenic
1016999151 6:149983734-149983756 CTTTTTTTTTTTGAGCTGGAAGG + Intergenic
1016999156 6:149983777-149983799 TTTTTTTTTTTTGAGCTGGAAGG + Intergenic
1016999161 6:149983818-149983840 TTTCTTTTTTTTGAGCTGGAAGG + Intergenic
1016999166 6:149983860-149983882 CTTTTTTTTTTTGAGCTGGAAGG + Intergenic
1016999171 6:149983901-149983923 TTTCTTTTTTTTGAGCTGGAAGG + Intergenic
1016999176 6:149983943-149983965 TTCTTTTTTTTTGAGCTGGAAGG + Intergenic
1016999211 6:149984177-149984199 TTCTTTTTTTTTGAGCTGGAAGG + Intergenic
1016999216 6:149984218-149984240 TTTCTTTTTTTTGAGCTGGAAGG + Intergenic
1016999221 6:149984251-149984273 TTTTTTTTTTTTGAGCTGGAAGG + Intergenic
1016999241 6:149984398-149984420 TTTCTTTTTTTTGAGCTGGAAGG + Intergenic
1016999251 6:149984484-149984506 TTTTTTTTTTTTGAGCTGGAAGG + Intergenic
1016999256 6:149984525-149984547 TTTTTTTTTTTTGAGCTGGAAGG + Intergenic
1017008347 6:150044300-150044322 TTTTTTTTTTTTGAGCTGAAAGG - Intergenic
1017027732 6:150196456-150196478 TTTTTTTTTTTGAATCTCTAAGG + Intronic
1017056712 6:150443277-150443299 ATTTTTTTTTTGAGGGTGGATGG - Intergenic
1017083961 6:150696372-150696394 GATTTTCTTCTGAAGCTGGCAGG - Intronic
1017481568 6:154861502-154861524 TTTTTTTTTTTAAGACTGGATGG - Intronic
1017724818 6:157269562-157269584 CCTTTTCTTCTGAAGCTGCAGGG + Intergenic
1017904942 6:158751540-158751562 TTTTTTCTTTTGCAGGTGGTGGG + Intronic
1017943886 6:159077937-159077959 TTTTTTCTTTTGTAGATACAGGG + Intergenic
1018352682 6:162977574-162977596 TTATTGCTCTTGAAGTTGGAAGG - Intronic
1018688690 6:166325260-166325282 TTTTTTATTTTGATGATGTAAGG - Intronic
1020162420 7:5782340-5782362 TTTTTTTTTTTCGAGATGGAGGG - Intergenic
1020237560 7:6368117-6368139 TTTTCTCTTTGGAAGCTTGTAGG + Intergenic
1020415168 7:7937283-7937305 TTTTTTTTTTTGAAGGAGGACGG + Intronic
1020490366 7:8775376-8775398 TTTTTTGTTTTGTCTCTGGAAGG + Intergenic
1020584482 7:10049085-10049107 TTTTTTCTTTGGAAGCCTGCTGG - Intergenic
1021411430 7:20332483-20332505 TTTTTTTTTTTTAAGCCGAAAGG - Intronic
1021832930 7:24635507-24635529 TTATTTCTTTTTAACCTGAATGG + Intronic
1021959636 7:25858825-25858847 TTTTTTTTTTTGAGGCCGGACGG - Intergenic
1022441188 7:30434941-30434963 TTTTTTTTTTTGTAGATAGAGGG + Intronic
1022677782 7:32515872-32515894 TTTTTTCTTTTGCAGCAGCAAGG - Intronic
1023056405 7:36293654-36293676 TTTTTTCTTTTTAAAATGTATGG - Intronic
1023223799 7:37948350-37948372 TTTTTTTTTTTGATGGTGGACGG + Intronic
1023536856 7:41222465-41222487 TTTTGACTTTTGAAAATGGAAGG - Intergenic
1023721457 7:43099449-43099471 TTTTTTCTTTGGAATCTCAAAGG - Intergenic
1023910467 7:44551923-44551945 TTTTTTTTTTTGAGCCAGGATGG - Intergenic
1023925384 7:44665275-44665297 TTTTTTTTTTTTAACCTGGAGGG - Intronic
1024127227 7:46311909-46311931 TTTTTTTTTTTGCAACTAGATGG + Intergenic
1024493888 7:50019956-50019978 TTTTATCGCTTGAACCTGGAAGG + Intronic
1024508158 7:50180932-50180954 TTTCTTCTTTTAAACCTGGAGGG + Intergenic
1024791811 7:52973492-52973514 TTTGTTCTTTTGATGCTTGAAGG - Intergenic
1024888075 7:54167582-54167604 TGTTTTGTTTTGCAGCTGCAAGG + Intergenic
1025265197 7:57450710-57450732 TTTTTTCTTTTAGAGATGTATGG + Intronic
1025293110 7:57748826-57748848 TTTTTTTTTTTTGAGGTGGAGGG - Intergenic
1025455987 7:60527370-60527392 TTTTTTCATTTAATGCTAGACGG + Intergenic
1025537613 7:61975256-61975278 TTTTTTCATTTAATGCTAGATGG + Intergenic
1025722891 7:64032537-64032559 TTTTTTTTTTTTGAGGTGGATGG - Intronic
1026229196 7:68468636-68468658 TTCTTTCTTTTCAGGCTGGCTGG - Intergenic
1026375107 7:69742120-69742142 TTTTTTTTTTTGAGGGGGGAGGG + Intronic
1026825179 7:73577253-73577275 TTTTTTTTTTTGCAGGGGGACGG - Intronic
1026866429 7:73826931-73826953 TTTTTGTTTTTGATCCTGGAGGG + Intronic
1026907356 7:74070156-74070178 TTTTTTTTTTTGTAGCTATATGG - Intergenic
1027180532 7:75936274-75936296 TTTTTTTTTTTTGAGATGGAGGG + Intronic
1027197558 7:76041166-76041188 TTTTTTTTTTTGGAGATGGGGGG - Intronic
1027301028 7:76835554-76835576 TTTTTTTTTTTTGAGATGGAGGG - Intergenic
1027345421 7:77254491-77254513 TTTTTTTTTTTGCAGCTTAAAGG + Exonic
1027350501 7:77306613-77306635 CCTTTTCTTTTGCAGCTGGGAGG - Intronic
1027442440 7:78233834-78233856 AATTTTCTTTTGAAGCCAGAGGG + Intronic
1027886103 7:83907879-83907901 TTTGTTCTTATGAACCTTGAAGG + Intergenic
1027915490 7:84313935-84313957 TTTTTTCTTCTTCAGTTGGATGG + Intronic
1028183011 7:87747907-87747929 TCTTTTCTTTTGCACCTGGGAGG - Intronic
1028312720 7:89359168-89359190 TATTTTCTTTTGGAGGGGGAGGG + Intergenic
1029034078 7:97500225-97500247 TTTTTTTTTTTTTAGATGGATGG + Intergenic
1029863443 7:103600419-103600441 TTTTTTCCTATGGAGCTGGTTGG + Intronic
1029884307 7:103850664-103850686 CTCTTTCTTTCGCAGCTGGAAGG + Intronic
1030075726 7:105734640-105734662 TTTTTTTTTTTTAACCTGGCTGG + Intronic
1030411023 7:109180371-109180393 TTTTTTCTTTTGACCCTGGCAGG - Intergenic
1030507619 7:110444819-110444841 TTTTCTTTTTTGAAGGGGGATGG - Intergenic
1030679465 7:112419653-112419675 TTTTTTCTTTTCAATTTGTATGG - Intergenic
1031448524 7:121884894-121884916 TTCTTCCTTTTGAACATGGATGG + Intronic
1031468512 7:122143392-122143414 TTTCTTCTTCTGAAGCTGTCAGG + Intronic
1031519323 7:122744171-122744193 TTTTTTCTTTTCCTGCTGAATGG + Intronic
1031601909 7:123720333-123720355 TTTTTTTTTTTGCAGCTGTATGG - Intronic
1032084266 7:128875630-128875652 TTTTTTCTTCTGGAGATGGATGG + Intronic
1032212214 7:129926164-129926186 TTTTTTCTTTTCAAGATAAAGGG + Intronic
1033427516 7:141257762-141257784 TATTTTCTTTTAAATCTAGATGG + Intronic
1033605652 7:142926475-142926497 TCTTTTCTACTGAAGCTGGAGGG + Intronic
1033796064 7:144846331-144846353 TTTTAGCTTTTTAAGTTGGAAGG + Intergenic
1034778621 7:153855832-153855854 TATTTTTTTTTGAATCTAGAAGG - Intergenic
1034864032 7:154625319-154625341 TTTTTTTTTTTTAAGATAGAAGG + Intronic
1035579922 8:732996-733018 TTTTTCGTTTGGAAACTGGAAGG + Intronic
1036526147 8:9536540-9536562 TTTTTTTTTTTGAAGATATAAGG - Intergenic
1036667247 8:10755275-10755297 TTTTTTTTTTTTAAGATGGAGGG + Intronic
1036926066 8:12907357-12907379 TTTTTAATGTTGAAGCAGGAGGG + Intergenic
1036968229 8:13324820-13324842 TATTTTCCTTTGAATCTTGAAGG + Intronic
1037189695 8:16108753-16108775 TTTTGCCTTTTTAAGTTGGACGG + Intronic
1037553561 8:19999130-19999152 TTTTTTCTTTTTAACCTGTAGGG - Intergenic
1037762241 8:21749228-21749250 TTTTTTTTTTTGCAGGGGGAGGG - Intronic
1037867914 8:22462234-22462256 TTTTTTCTTTTTAAGAGAGAGGG - Intronic
1038635982 8:29287662-29287684 TTTTTCCTTTTAAAGCTAGAAGG - Intergenic
1038645560 8:29358815-29358837 TTTTTTCTTTTTAAGCTGAGAGG + Intergenic
1038844565 8:31216748-31216770 CTTTTCCTTCTCAAGCTGGAGGG + Intergenic
1039123519 8:34175397-34175419 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
1039268451 8:35854456-35854478 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
1039536368 8:38317745-38317767 TTTTTTCGGTTTGAGCTGGATGG - Intronic
1039557710 8:38488562-38488584 GTTTTTCCCTTGGAGCTGGAAGG - Intergenic
1039571781 8:38592771-38592793 TATTTGCTTTTGCAGCTGGGAGG + Intergenic
1039575057 8:38616398-38616420 TTGTTTCCTTAGGAGCTGGAAGG + Intergenic
1039949116 8:42153663-42153685 TTTTTTTTTTTGGAGGTGGAGGG + Intronic
1040851268 8:51902387-51902409 TTTTTTTTTTTGCAGGGGGAGGG - Intergenic
1040906212 8:52472199-52472221 TTTTTTCTTTTGTAGAGGGAGGG - Intergenic
1041125354 8:54632204-54632226 ATTTTTCTTTTTAATTTGGAAGG + Intergenic
1041258398 8:55999228-55999250 TTTATTATTTTGAACCTGGGAGG + Intronic
1041275523 8:56153819-56153841 TTTTTTTTTTTGCAAATGGATGG - Intergenic
1041336391 8:56789345-56789367 TTTTATATTATGTAGCTGGAGGG - Intergenic
1041570606 8:59333359-59333381 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
1041625999 8:60027808-60027830 TTTTTTCAGTGGAAGATGGAGGG + Intergenic
1042266732 8:66916143-66916165 TTTTTTTTTTTAAAGATAGAAGG + Intronic
1042455636 8:68999264-68999286 TTTTTTTTTTTGTAGAGGGATGG - Intergenic
1042685235 8:71431492-71431514 TTTCTTTTTTTGAAGAGGGAGGG - Intronic
1042719991 8:71817198-71817220 TTTTTGGTTTTTAAGCTGAATGG - Intergenic
1042963316 8:74325375-74325397 TTTTTTTTTTTAAAGGAGGAAGG + Intronic
1042992797 8:74659472-74659494 ATTTTTTTGCTGAAGCTGGAGGG + Intronic
1043367479 8:79551672-79551694 TTTATTCTTTTGAATTTGAAGGG - Intergenic
1043529925 8:81137924-81137946 TTTTATCTTATGAAGTTGTAAGG - Intergenic
1043565349 8:81541590-81541612 TTTTTTCTTTTTTAACTGAATGG + Intergenic
1043574628 8:81643544-81643566 TTTTTTTTTTTTGAGGTGGATGG - Intergenic
1044359327 8:91262666-91262688 TTTTTTCTCCTGAATATGGAGGG + Intronic
1044461482 8:92449802-92449824 TTTTTTTTTTTGAATCCGGATGG - Intergenic
1045323144 8:101097035-101097057 TTTTTTCTTTTTTAACTAGAAGG - Intergenic
1045605728 8:103772197-103772219 TTCTTTCTTTTCAATCTAGATGG - Intronic
1046019008 8:108641178-108641200 TTTGTCCTTTTGAAGTTGGCAGG + Intronic
1046120572 8:109841255-109841277 TTTTTTTTTTTGAGACTGGGAGG + Intergenic
1046567695 8:115921894-115921916 TTTTTTCTTTTAAACTTGAAGGG - Intergenic
1047136416 8:122083523-122083545 TTTGTGCTTTGGAAGCTCGAAGG - Intergenic
1047705256 8:127492813-127492835 TTTTGGCTTTTGAAGGTGAAAGG - Intergenic
1047788081 8:128173860-128173882 TTTTTTCTTTTGAGAATGGGTGG + Intergenic
1047872617 8:129101688-129101710 CTTTTGTTTTTGGAGCTGGAGGG - Intergenic
1048100127 8:131342059-131342081 TTTTTTCTTTTGAAGGCAGAAGG - Intergenic
1048244371 8:132776751-132776773 TTTTTTCTTTTTAAACTGTAGGG + Intronic
1048252472 8:132878183-132878205 TTTCTTCTATTGATGATGGAGGG + Intronic
1048602578 8:135933752-135933774 TTTTTACTTTTCAAGCTAGAAGG + Intergenic
1048957698 8:139550308-139550330 TTTTTTTTTTTTAAGCTTGAAGG + Intergenic
1049153295 8:141050284-141050306 TTTTTTTTTTTGGAGCGAGATGG - Intergenic
1049295988 8:141838717-141838739 CAATTTCTTTTTAAGCTGGAAGG + Intergenic
1049903712 9:195862-195884 TTTTCTCTTTTGAATGTGGTAGG + Intergenic
1049912473 9:282578-282600 TTTTTTTTTTTAAAGTTAGATGG - Intronic
1050266058 9:3891055-3891077 TTTTTTTTTTTGAGGAAGGAAGG - Intronic
1050274077 9:3978209-3978231 TTTTTTTTTTTTAAACTGGGTGG + Intronic
1050521321 9:6503398-6503420 GTTTTTTTTTTTAAGCTAGAAGG - Intronic
1050548350 9:6728055-6728077 TTTTTTTTTTTGCAGCTTCATGG - Intronic
1050918081 9:11162524-11162546 TTTTTTTTTTACAGGCTGGAAGG + Intergenic
1050967620 9:11827046-11827068 TTTTTTCATTTGCAGCAAGATGG + Intergenic
1050990524 9:12145720-12145742 TTTTTTTTTTTTAATCTAGAGGG - Intergenic
1051261638 9:15270599-15270621 TTTTTTCTTTTTTTGATGGAGGG - Intronic
1051362632 9:16294634-16294656 TTTTTTCTTTCGCAGCTGGAAGG + Intergenic
1051368285 9:16336714-16336736 TTTTTTTTTTTTAATCTGTAAGG - Intergenic
1051381351 9:16462212-16462234 TTTTTTCTTTGGCTGGTGGATGG - Intronic
1051857303 9:21583102-21583124 TTTATTCTCTAGATGCTGGAGGG + Intergenic
1051890174 9:21933190-21933212 TTTTTTCTTTTGAAGCTGGATGG + Intronic
1052240945 9:26272645-26272667 TTTTAACTTTGTAAGCTGGATGG - Intergenic
1052420702 9:28240323-28240345 TTTTTTCTTTTTACTCAGGATGG - Intronic
1052479663 9:29007705-29007727 TTTTTATTTTAGTAGCTGGATGG + Intergenic
1052583921 9:30399408-30399430 TTTTTTTTTTTAAGGCTGAATGG - Intergenic
1052836498 9:33254154-33254176 TTTTTTTTTTTAAAGCAGAATGG + Exonic
1052994580 9:34544675-34544697 TTTTTTCTTTTTTAGACGGAAGG + Intergenic
1053079227 9:35160797-35160819 TTTTTTCTTTTGCAGCTGTGAGG + Intergenic
1053094723 9:35315062-35315084 TTTTTTTTTTTGTAGATGCAGGG + Intronic
1053243090 9:36512441-36512463 TTTTTTTTTTTTAAGGGGGATGG - Intergenic
1053694042 9:40618910-40618932 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1053746718 9:41206166-41206188 TTTTCTCTTTTGAATGTGGTAGG + Intergenic
1053941033 9:43249329-43249351 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1054270793 9:63021217-63021239 AATTTCCTTTGGAAGCTGGATGG + Intergenic
1054305287 9:63418134-63418156 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1054404034 9:64742123-64742145 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1054415238 9:64869497-64869519 ATTTTTCTTTTAAGACTGGATGG - Intergenic
1054437655 9:65227623-65227645 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1054480566 9:65659191-65659213 TTTTCTCTTTTGAATGTGGTAGG - Intergenic
1054492748 9:65794344-65794366 AATTTCCTTTGGAAGCTGGATGG + Intergenic
1054681627 9:68225116-68225138 TTTTCTCTTTTGAATGTGGTAGG - Intergenic
1054738902 9:68784796-68784818 ATTTTTCTTCTGAAACAGGAGGG + Intronic
1054867813 9:70020555-70020577 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
1055167323 9:73212533-73212555 TTTTTTTTTTTTGAGATGGATGG - Intergenic
1055496982 9:76865318-76865340 TTTTTACTTTTGTAGCGGCAGGG - Intronic
1055512235 9:77006321-77006343 TTTTTTCTTTTTAAATTAGAGGG - Intergenic
1055588241 9:77780446-77780468 TTTTTTTTTTTATGGCTGGACGG + Intronic
1055857995 9:80715542-80715564 TTTTTTTTTTTTGAACTGGAGGG - Intergenic
1056046997 9:82729172-82729194 GTTTTAATTTTTAAGCTGGAGGG + Intergenic
1056127382 9:83548961-83548983 TTTTTTTATTTTAAGCTTGAGGG + Intergenic
1056328409 9:85501469-85501491 TTTTCTGTTTTGCAGCTAGATGG - Intergenic
1057249919 9:93492890-93492912 TGTTTTCTTTTGAAGTGGGATGG + Intronic
1057489452 9:95509992-95510014 TTTTTTTTTTTTAAGTTGGGGGG - Intronic
1057492061 9:95528098-95528120 TGTTTACTCTTGAGGCTGGACGG + Intergenic
1057638237 9:96791803-96791825 TTTTTTTTTTTTAACCTGGAGGG + Intergenic
1057669903 9:97077946-97077968 TTTTTTTTTTTGGAGATGGCTGG + Intergenic
1057742338 9:97722668-97722690 TTTTTTCTTTCCAAGTTGTATGG + Intergenic
1058957940 9:109966629-109966651 TTTTATCTTTTAAATCTGGATGG + Intronic
1059002692 9:110366583-110366605 TTTTTTCTTTTGAATCTATTTGG - Intronic
1059486516 9:114631271-114631293 TTTTTTTTTTTGAGGCAGGCTGG - Intronic
1059834647 9:118137432-118137454 TTTTTTCTTTTCAAGTGGTATGG - Intergenic
1060116622 9:120946484-120946506 TTATTTCTTTTCTAGCTGGGAGG - Intergenic
1060117945 9:120959565-120959587 TTTTTCATTTTGAAATTGGAAGG - Intronic
1060600962 9:124877073-124877095 TATTTTATTTTCAAGGTGGAGGG + Exonic
1061772839 9:132940011-132940033 TTTTTCCTTTTGAACCTCAAAGG - Intronic
1061960758 9:133987880-133987902 TCATTTCTTCTGAAGCTGGCAGG - Intronic
1062258969 9:135648348-135648370 TTTTCTCTTTTGCAGCTTCAAGG - Intergenic
1202782848 9_KI270718v1_random:16945-16967 TTTTCTCTTTTGAATGTGGTAGG + Intergenic
1185580256 X:1206619-1206641 TTTTTTGTTTTGTTGCTGAATGG - Intronic
1185855231 X:3528123-3528145 TTTGGTCATTTGAGGCTGGAGGG - Intergenic
1186274153 X:7921838-7921860 TTTCTTCTTTAGAAGTGGGATGG - Exonic
1186307694 X:8281672-8281694 TTTTTTCTTTTGAATAGGCAGGG - Intergenic
1186400942 X:9258947-9258969 TTTTTCCTATTGAAACTGAAAGG + Intergenic
1186502033 X:10059121-10059143 CTTTTTCATTTGAAGCTAAATGG + Intronic
1186613579 X:11163216-11163238 TTTTTTTCTCTGAAGCAGGAGGG - Intronic
1186723540 X:12331229-12331251 TTTTTTTTTTTTAACATGGAAGG + Intronic
1186845236 X:13524198-13524220 TTTAATCTTTTGAAGCTTGTTGG + Intergenic
1187135876 X:16546729-16546751 TTTTTACTTTTGATGATGAATGG - Intergenic
1187761059 X:22585705-22585727 TGTTTTGTTTTGAAGGTAGATGG - Intergenic
1187828467 X:23356591-23356613 TTATTTGATTTGAGGCTGGAAGG - Intronic
1188645760 X:32565014-32565036 TTTTGTCTTATGTAGTTGGATGG - Intronic
1188780358 X:34276407-34276429 TTTTCTCTTTTGAAAATGTAAGG + Intergenic
1188931812 X:36120742-36120764 TTTTTTTTTTTAAAGTTTGAAGG + Intronic
1188960566 X:36486584-36486606 TGTTTTCTCTGGAAGGTGGAGGG - Intergenic
1189082167 X:37986208-37986230 TTTTTTTTTTTAAAGAAGGAAGG + Intronic
1189094616 X:38125066-38125088 TATTTTCTTTTCAAGATGGAAGG + Intronic
1189603133 X:42648545-42648567 CCTTTTCTTTTGTAGCTGGAAGG + Intergenic
1189650390 X:43183016-43183038 TTTTTTCTTTTGAAGGTCTATGG - Intergenic
1190360021 X:49639978-49640000 TTTTTTTTTTTTAAACTAGACGG + Intergenic
1190689200 X:52899453-52899475 TATTTTCTTTTGTAGGTGAAAGG + Exonic
1190696783 X:52956339-52956361 TATTTTCTTTTGTAGGTGAAAGG - Exonic
1190700651 X:52986844-52986866 TCTTTCCTTTTTAAGCTGGTTGG - Intronic
1191067663 X:56367398-56367420 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
1191401273 X:60272894-60272916 TTCTTTCTTTGGAATCTGCAAGG + Intergenic
1191788475 X:64943119-64943141 TGTCTTCTTTTGAAGTTGTATGG + Intronic
1191903620 X:66064603-66064625 CCTTTTCTTTTGTAGCTGGGAGG - Intergenic
1192014758 X:67317454-67317476 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
1192067078 X:67896740-67896762 TTTTCTCTTTTGCAGCTGTGAGG + Intergenic
1192402501 X:70850567-70850589 TTTTTTTTTTTGTAGAGGGAGGG - Intronic
1192451750 X:71249304-71249326 GTTTTATTTTTGAAGCTGGCTGG - Intronic
1192655791 X:72992705-72992727 TTTTTTTTTTTTAGGCTGTATGG - Intergenic
1192688930 X:73339180-73339202 TTGTTTCTTTTTATGCTGAATGG - Intergenic
1192837001 X:74810624-74810646 TTTTTTTTTTTGTAGAGGGAGGG - Intronic
1192914566 X:75638506-75638528 TCTTTTCTTTTGCAGCTGGGAGG - Intergenic
1192956561 X:76076633-76076655 TTTTTTGTGTTGAAGCTTTAAGG - Intergenic
1193076963 X:77364733-77364755 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
1193104342 X:77652070-77652092 CTTTTTCTTTTGTAGCTACAGGG - Intronic
1193404209 X:81082380-81082402 TCTTTACTTTTGCAGCTGGAAGG + Intergenic
1193427509 X:81357231-81357253 TTATGTCTTTTGGAGCTGGAAGG + Intergenic
1193505582 X:82338332-82338354 TTTTTTCTTTTGTATCTAGTAGG + Intergenic
1193791599 X:85821591-85821613 TACTTTCTTTTGCAGCTGGGAGG + Intergenic
1193875607 X:86858782-86858804 TTCTTTCTTTTCAGGTTGGATGG - Intergenic
1193989180 X:88284960-88284982 TTGTTGGTTTTGAAGATGGAAGG + Intergenic
1194156130 X:90391435-90391457 TTTTTTCTTTTGACTAAGGAGGG + Intergenic
1194926968 X:99836777-99836799 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
1196218858 X:113088127-113088149 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
1196382690 X:115109368-115109390 TTTCCTCTTTTGCAGCTGCAAGG + Intergenic
1196652895 X:118186948-118186970 TTTTTTCTTTTTAAACAGAAAGG + Intergenic
1196769031 X:119274390-119274412 TTATATCTTTTGAAAGTGGAAGG + Intergenic
1197003186 X:121463582-121463604 TTTTTTTTTTTTTTGCTGGAAGG + Intergenic
1197324379 X:125074261-125074283 TTTTTTTTTTTTAACCTAGATGG + Intergenic
1197535680 X:127686478-127686500 TTTTTGATTTTGAGTCTGGAAGG + Intergenic
1197671708 X:129284660-129284682 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
1197874806 X:131091449-131091471 TGGTTTGTTTTGAAGCTGAATGG - Intergenic
1198221648 X:134608021-134608043 ATTTTTCTTTTGCAGCTTGAAGG - Intronic
1198730270 X:139720771-139720793 TTTTTTTTTTTAAAGCGGGGGGG - Intergenic
1198843190 X:140880772-140880794 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1199193845 X:145003858-145003880 TCTTTTCTTTTGTAGCTGTGAGG + Intergenic
1199339917 X:146665363-146665385 TTTTATCTTTTTGAGCTGCATGG - Intergenic
1199421224 X:147646829-147646851 TTTTTTCCTTTGAAGCTGAGAGG + Intergenic
1199584751 X:149402788-149402810 TTTTTTTTTTTTAAGATGAAAGG + Intergenic
1199706629 X:150431751-150431773 TTTTTTTTTTTACAGCTGCATGG + Intronic
1199797722 X:151217345-151217367 TTTTTTTTTTTACAGCTGTATGG + Intergenic
1199910089 X:152277414-152277436 ATTTTTCTCATTAAGCTGGATGG + Intronic
1200285757 X:154820723-154820745 TTTTCTCTTTTGCAGCTGCGAGG + Intronic
1200331080 X:155298621-155298643 TTTTTGTATTTGAAGTTGGAGGG + Intronic
1200502476 Y:3968408-3968430 TTTTTTCTTTTGACTAAGGAGGG + Intergenic
1201191813 Y:11450463-11450485 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1201221727 Y:11777649-11777671 TTTTTTTTTTTGTAGCGAGATGG - Intergenic
1201621057 Y:15958316-15958338 TTTTTTTTTTTGAAACTTAAAGG + Intergenic
1201968250 Y:19762249-19762271 TTTTTTTTTTTAAATCTGTATGG + Intergenic
1201968925 Y:19770351-19770373 TTTTTTCGTTTGAAACTTGCAGG - Intergenic
1202165494 Y:21983017-21983039 TTTTTTCTTTTGCAGCAAAAGGG - Intergenic
1202225863 Y:22603355-22603377 TTTTTTCTTTTGCAGCAAAAGGG + Intergenic
1202317250 Y:23592306-23592328 TTTTTTCTTTTGCAGCAAAAGGG - Intergenic
1202553515 Y:26077752-26077774 TTTTTTCTTTTGCAGCAAAAGGG + Intergenic