ID: 1051893291

View in Genome Browser
Species Human (GRCh38)
Location 9:21965108-21965130
Sequence GCTCCGAGGTCGCCGCACCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051893281_1051893291 12 Left 1051893281 9:21965073-21965095 CCGGCCAAAGGAAGGGCTGCTCT 0: 1
1: 0
2: 1
3: 15
4: 228
Right 1051893291 9:21965108-21965130 GCTCCGAGGTCGCCGCACCCGGG No data
1051893280_1051893291 13 Left 1051893280 9:21965072-21965094 CCCGGCCAAAGGAAGGGCTGCTC 0: 1
1: 0
2: 4
3: 12
4: 223
Right 1051893291 9:21965108-21965130 GCTCCGAGGTCGCCGCACCCGGG No data
1051893282_1051893291 8 Left 1051893282 9:21965077-21965099 CCAAAGGAAGGGCTGCTCTCCCG 0: 1
1: 0
2: 1
3: 12
4: 130
Right 1051893291 9:21965108-21965130 GCTCCGAGGTCGCCGCACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051893291 Original CRISPR GCTCCGAGGTCGCCGCACCC GGG Intronic
No off target data available for this crispr