ID: 1051893291 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:21965108-21965130 |
| Sequence | GCTCCGAGGTCGCCGCACCC GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1051893281_1051893291 | 12 | Left | 1051893281 | 9:21965073-21965095 | CCGGCCAAAGGAAGGGCTGCTCT | 0: 1 1: 0 2: 1 3: 15 4: 228 |
||
| Right | 1051893291 | 9:21965108-21965130 | GCTCCGAGGTCGCCGCACCCGGG | No data | ||||
| 1051893280_1051893291 | 13 | Left | 1051893280 | 9:21965072-21965094 | CCCGGCCAAAGGAAGGGCTGCTC | 0: 1 1: 0 2: 4 3: 12 4: 223 |
||
| Right | 1051893291 | 9:21965108-21965130 | GCTCCGAGGTCGCCGCACCCGGG | No data | ||||
| 1051893282_1051893291 | 8 | Left | 1051893282 | 9:21965077-21965099 | CCAAAGGAAGGGCTGCTCTCCCG | 0: 1 1: 0 2: 1 3: 12 4: 130 |
||
| Right | 1051893291 | 9:21965108-21965130 | GCTCCGAGGTCGCCGCACCCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1051893291 | Original CRISPR | GCTCCGAGGTCGCCGCACCC GGG | Intronic | ||
| No off target data available for this crispr | |||||