ID: 1051894703

View in Genome Browser
Species Human (GRCh38)
Location 9:21975102-21975124
Sequence CTTCCGGCTGGTGCCCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051894703_1051894718 20 Left 1051894703 9:21975102-21975124 CCCCCGGGGGCACCAGCCGGAAG 0: 1
1: 0
2: 0
3: 5
4: 122
Right 1051894718 9:21975145-21975167 GTTGGCAAGGAAGGAGGACTGGG No data
1051894703_1051894717 19 Left 1051894703 9:21975102-21975124 CCCCCGGGGGCACCAGCCGGAAG 0: 1
1: 0
2: 0
3: 5
4: 122
Right 1051894717 9:21975144-21975166 CGTTGGCAAGGAAGGAGGACTGG No data
1051894703_1051894712 7 Left 1051894703 9:21975102-21975124 CCCCCGGGGGCACCAGCCGGAAG 0: 1
1: 0
2: 0
3: 5
4: 122
Right 1051894712 9:21975132-21975154 CGCCAGAGCCAGCGTTGGCAAGG No data
1051894703_1051894709 2 Left 1051894703 9:21975102-21975124 CCCCCGGGGGCACCAGCCGGAAG 0: 1
1: 0
2: 0
3: 5
4: 122
Right 1051894709 9:21975127-21975149 GCCCTCGCCAGAGCCAGCGTTGG No data
1051894703_1051894714 11 Left 1051894703 9:21975102-21975124 CCCCCGGGGGCACCAGCCGGAAG 0: 1
1: 0
2: 0
3: 5
4: 122
Right 1051894714 9:21975136-21975158 AGAGCCAGCGTTGGCAAGGAAGG No data
1051894703_1051894715 14 Left 1051894703 9:21975102-21975124 CCCCCGGGGGCACCAGCCGGAAG 0: 1
1: 0
2: 0
3: 5
4: 122
Right 1051894715 9:21975139-21975161 GCCAGCGTTGGCAAGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051894703 Original CRISPR CTTCCGGCTGGTGCCCCCGG GGG (reversed) Intronic
902747222 1:18482048-18482070 CTTCCGGCTGAAGCCTCGGGTGG - Exonic
903583760 1:24392502-24392524 CTTCCAGCTGGTGCCACAGGAGG - Intronic
910728239 1:90360887-90360909 CTCCCGGCTGAAGCCCCAGGAGG + Intergenic
919083729 1:192895614-192895636 CTTCCGGCTGCTGGCTCAGGTGG + Intergenic
924483381 1:244456330-244456352 CTTCAGGGTGGAGCCCCTGGAGG - Intronic
1066446728 10:35490784-35490806 TTTCCATCTGGTGCCCCTGGAGG + Intronic
1066460465 10:35608306-35608328 CCTCCGGCGCGTGCACCCGGGGG - Exonic
1067537829 10:47127585-47127607 CTTCCTGCTGGTGCTGCCCGAGG - Intergenic
1072611426 10:97019745-97019767 CTTACGGGTGGTGTCCCAGGCGG - Intronic
1075726332 10:124612740-124612762 CTTCTGGTTGGTGCCCTCTGAGG - Intronic
1078141901 11:8699185-8699207 CCCCCAGCTGGTTCCCCCGGTGG + Intronic
1082179076 11:49097176-49097198 CTTCAGGCTGTTGCCCCCATGGG + Intergenic
1084112697 11:67023964-67023986 ACTCAGGCTGGTGCCACCGGCGG - Intronic
1086686206 11:89735739-89735761 CTTCAGGCTGTTGCCCCTGTGGG - Intergenic
1086700331 11:89894590-89894612 CTTCAGGCTGTTGCCCCTGTTGG + Intergenic
1086705839 11:89949936-89949958 CTTCAGGCTGTTGCCCCTGTTGG - Intergenic
1087672938 11:101128280-101128302 CCTCCTGCTGCCGCCCCCGGCGG + Exonic
1089494999 11:118903314-118903336 CTTCGGCCTGATGCCCCTGGGGG - Exonic
1092192949 12:6533690-6533712 CTCCGGGCTGGGGCCCCAGGCGG - Intergenic
1094329072 12:29273036-29273058 CATCAGGCTGGTGCCCCTCGAGG - Intronic
1096519665 12:52177514-52177536 CTTCCAGCCTGTGCCCCCAGGGG + Intronic
1102517999 12:113463140-113463162 CTTCGGGGCGGGGCCCCCGGGGG + Exonic
1108689442 13:52848070-52848092 GTTCCGGCTGGTGCACGTGGAGG - Exonic
1111045254 13:82805812-82805834 CTTCAGGTTGGTGCCCCTTGAGG + Intergenic
1117842132 14:59870697-59870719 CTCCCTGCTGCTGTCCCCGGAGG + Exonic
1122983786 14:105203129-105203151 CTTCCAGATGGTGCCGCCCGTGG + Intergenic
1122984411 14:105205618-105205640 CTTCCGGCTGCTGGCCTGGGCGG - Intergenic
1123935313 15:25191233-25191255 CTTCCAGATGGTGACCCCAGAGG + Intergenic
1126739104 15:51759977-51759999 TTTCCTGCTAGTGCCCCCTGTGG + Intronic
1127687621 15:61364509-61364531 CATCAGGCTGGTGCCCCTCGAGG - Intergenic
1132330237 15:101007642-101007664 CTCCCGGCAGGAGGCCCCGGAGG - Intronic
1132750118 16:1453683-1453705 CTTCCTGATGGTTTCCCCGGTGG - Intronic
1133050399 16:3114239-3114261 CTTCTGTCTGGTGCGCACGGCGG + Intronic
1140652672 16:77105806-77105828 CTTCCTGCTGGTGCCAAAGGAGG + Intergenic
1140894699 16:79314650-79314672 ATGCCGGCTGGTTCCCCTGGAGG + Intergenic
1142005044 16:87685626-87685648 GTTCTGGCAGGTGCCCCCGACGG - Intronic
1146492198 17:33291467-33291489 CCTCCAGCTGGTGGCCCAGGCGG + Exonic
1146501301 17:33367137-33367159 CTTCCTGCTGGTGCTTCCAGTGG + Intronic
1147176154 17:38657457-38657479 CTTCTGGCTGGGGCTCCGGGAGG - Intergenic
1147721658 17:42543337-42543359 GTTCTGGCTGATGCCCTCGGGGG - Exonic
1147811243 17:43171269-43171291 CCTCCGGCAGGCGCCCCCCGGGG + Intronic
1150764539 17:67993170-67993192 CATCCGGCTGGTGACCCTGCTGG - Exonic
1150765536 17:67998898-67998920 CTTCCAGCTGGTGCCACCCCAGG - Intergenic
1151323671 17:73366145-73366167 CTTCCGGCTCCAGCCCCAGGAGG + Intronic
1151882979 17:76905939-76905961 CTCCTGGCCGGTGCCCCGGGGGG + Intronic
1152250200 17:79208503-79208525 CTTCTGGCTGTTTCCCCAGGTGG + Intronic
1152463787 17:80454735-80454757 CTTCCGGCCGGTGCCGGCCGCGG - Intergenic
1152754327 17:82080836-82080858 CTCCCTGCTGGTGAACCCGGAGG - Exonic
1154057559 18:11025916-11025938 CTTGCTGCTGCTGCCCCCAGCGG - Intronic
1158461318 18:57648557-57648579 CTTGCGGATGCTGCGCCCGGAGG + Exonic
1159028980 18:63211816-63211838 CTTCAGGCTGGTGCTGCCGCAGG - Intronic
1160810023 19:1009275-1009297 CTTCCTGCTGGAGCCCGCCGTGG + Exonic
1161241041 19:3224394-3224416 CTTCCGGCCGATGCCCTCCGCGG + Intergenic
1161395861 19:4044541-4044563 CTTCAGGCGGGGGCGCCCGGGGG - Exonic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1163110905 19:15160691-15160713 CTTCCGGCTGGGGCCCCAGCTGG + Exonic
1165520644 19:36311451-36311473 CTTCTGTTTGGTGGCCCCGGCGG - Intergenic
1166658686 19:44630645-44630667 CTTCCAGCTGATGCCCCCATTGG - Intronic
1167474104 19:49690269-49690291 CTTCCGCCTCGCGCCACCGGCGG - Exonic
1168686235 19:58351147-58351169 CTGCCAGGTGGTGCCCCCTGTGG + Intronic
925471904 2:4172233-4172255 CTTCAGGCTGGAGCCCTCAGAGG + Intergenic
925845205 2:8028132-8028154 CTCTGGGCTGGTTCCCCCGGCGG + Intergenic
925915231 2:8600046-8600068 CTTGCCCCTGGTGCCCCAGGTGG + Intergenic
933985051 2:87583977-87583999 ATTCCAGCTGGTCCACCCGGCGG - Intergenic
934580975 2:95437719-95437741 CTTCAGGCTGTTGCCCCTGTTGG - Intergenic
934598475 2:95638995-95639017 CTTCAGGCTGTTGCCCCTGTTGG + Intergenic
936308792 2:111366833-111366855 ATTCCAGCTGGTCCACCCGGCGG + Intergenic
937100368 2:119263871-119263893 CCTCCTGCTGCTGCCCCAGGTGG - Exonic
946415564 2:219538238-219538260 CCCCAGGCTGGTGCCCCGGGAGG + Exonic
946687083 2:222281168-222281190 TTTCCTCATGGTGCCCCCGGTGG - Intronic
1170496675 20:16931369-16931391 CATCGGGTTGGTGCCCCTGGAGG + Intergenic
1175329773 20:58155533-58155555 CATCCGGCCGGTGACCCCAGTGG + Exonic
1175958788 20:62624576-62624598 CCTCCAGGTGGTGCCCGCGGGGG + Intergenic
1176310448 21:5146282-5146304 CTTGCGGCTGAAGCCCCCTGCGG - Exonic
1177755394 21:25341158-25341180 CTTCAGTCTGGTGCCCCAGTGGG + Intergenic
1178545696 21:33491520-33491542 CCTCCAGCTGGTGCCTCCGCCGG + Intronic
1179166205 21:38937122-38937144 CATCAGGCTGGTGCCACAGGAGG + Intergenic
1179846607 21:44115753-44115775 CTTGCGGCTGAAGCCCCCTGCGG + Exonic
1181572165 22:23773481-23773503 CTGCCGGCAGGTGCCCGCGGGGG - Intronic
1181593496 22:23898418-23898440 CTTTGGGCTGGTGGCCCCAGGGG - Intronic
1184451805 22:44586872-44586894 CTTCCAGCTTCTGCCCACGGTGG - Intergenic
1185215803 22:49599393-49599415 CTTCCGGCTGGAGCGCTGGGAGG + Intronic
950028255 3:9835111-9835133 CTTCCAGCTGGGGGCCTCGGAGG - Exonic
955084779 3:55692258-55692280 CCTCAAGCTGGTGCCCCAGGAGG + Intronic
956716847 3:72086949-72086971 CTGCCGGCTGCTGCTCCCGCCGG - Intergenic
959627018 3:108464122-108464144 CTTCTGGCTGGTGACTCTGGTGG - Intronic
959781530 3:110239938-110239960 CTTCAGGCTGGTGATCCTGGAGG + Intergenic
962249887 3:133829396-133829418 CTTTCCACTGGTGCCCCCGGGGG + Intronic
968092419 3:195907601-195907623 ATTCCGCCTCGTGCCCCCAGGGG - Intronic
975985993 4:80202208-80202230 CTTCGCGCTGCTGCCGCCGGCGG - Exonic
984852195 4:184163990-184164012 CTTCCAGCGGGTGGCCCCAGAGG - Intronic
985555410 5:555594-555616 CTTCCCGCTTGTGTCCCCGTCGG - Intergenic
985616830 5:927554-927576 CTTCCGGCCTTTGCCCCCGCAGG + Intergenic
991454979 5:66793302-66793324 CTCCCGGCTGGTGTCCCAGCAGG - Intronic
997732625 5:136192326-136192348 CTTCCTGCTGCTGCTCTCGGTGG - Intergenic
999475201 5:151891843-151891865 CTTCCAGCAGGTGCCCCCAAAGG - Intronic
1002062023 5:176630646-176630668 CTTACGGCCGGGGCCCCCAGGGG - Intergenic
1002108701 5:176893528-176893550 CTTCCAGCTGGTGCTCCTCGTGG - Intronic
1005476380 6:26212125-26212147 CTTCCTGCTACTGCCCCCAGAGG + Intergenic
1006257592 6:32843948-32843970 ATTCCGGCCGCTGCCCTCGGGGG + Exonic
1007284599 6:40738396-40738418 CCTCCGGCTGGGGCTCCCTGGGG + Intergenic
1008900302 6:56606595-56606617 CTACCAACTGGTGCCCCCTGGGG + Intronic
1019179012 6:170175738-170175760 GCTCCTCCTGGTGCCCCCGGAGG + Intergenic
1019196092 6:170283899-170283921 ATCCCGGCAGGTGCCCCCGTTGG + Exonic
1019328209 7:449841-449863 CTTCTGGCTGGTGCTCCTGGGGG - Intergenic
1019578056 7:1746945-1746967 CTTCCTCCTTGTGCCGCCGGCGG - Exonic
1023800466 7:43829418-43829440 CTTCAGGCTGGAGCCCTTGGAGG - Intergenic
1028787077 7:94807535-94807557 CTTACCGCTGGTGACCCGGGCGG - Intergenic
1034517786 7:151594138-151594160 CTTTCAGCTGGTGCTCCCGAAGG + Intronic
1035431699 7:158828413-158828435 CTTCCTCCTGGTGCCGCCCGCGG - Intronic
1038450020 8:27633905-27633927 CTTCCCGCTGGGGCCCCGCGAGG - Intronic
1049300374 8:141866580-141866602 CCTCCTGCTGGTGGCCCAGGAGG - Intergenic
1049660875 8:143819211-143819233 CTACCTCATGGTGCCCCCGGGGG - Intronic
1049791813 8:144475717-144475739 CTCCCGCCTGGGGCCCCCAGAGG - Exonic
1051894703 9:21975102-21975124 CTTCCGGCTGGTGCCCCCGGGGG - Intronic
1055563293 9:77543213-77543235 TTTCAGGCTGGTGCCCACTGTGG + Intronic
1058447501 9:105066807-105066829 CTCCAGGCTGGAGCCCCCTGTGG - Intergenic
1061788248 9:133043873-133043895 CTCCCGGCTGGACGCCCCGGTGG + Exonic
1061883450 9:133579195-133579217 CTTCCTGCAGGAGCCGCCGGAGG - Exonic
1062326091 9:136013233-136013255 CTTCCGGCTGGGGTCGCTGGTGG + Exonic
1062582851 9:137236101-137236123 ATTCCTGCTGCTGCCCCTGGCGG + Exonic
1192692198 X:73375443-73375465 CATCAGGCTGGTGCCCCTGTGGG + Intergenic
1193130074 X:77910595-77910617 CTTCCGGGTGATGCCCCTGCCGG - Intergenic
1193514484 X:82446354-82446376 CATCAGGCTGGTGCCCCTGTGGG + Intergenic
1197046400 X:122003736-122003758 CATCAGGCTGGTGCCCCTCGAGG - Intergenic
1197403851 X:126027126-126027148 CATCAGGCTGGTGCCCCTCGAGG - Intergenic
1197829202 X:130623703-130623725 CTTCCTGCTGGTGCCACAGCAGG + Exonic
1199601151 X:149541787-149541809 CTGCGGGCTGGTGCACCCTGTGG + Exonic