ID: 1051898412

View in Genome Browser
Species Human (GRCh38)
Location 9:22012392-22012414
Sequence TAGGTGAGCTGGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 272}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051898412 Original CRISPR TAGGTGAGCTGGAAGAGTGA AGG (reversed) Intronic
900132200 1:1091918-1091940 GAGGTGGGGTGAAAGAGTGAAGG + Intronic
902689059 1:18098314-18098336 TAGGGGAGATGGGAGAGGGAGGG + Intergenic
904987486 1:34563804-34563826 CTGGAGACCTGGAAGAGTGAGGG - Intergenic
905208673 1:36358202-36358224 GAGGTGAGCGCGAAGGGTGAGGG + Intronic
905603606 1:39275587-39275609 TAGGCGAGGATGAAGAGTGATGG + Intronic
905880460 1:41460003-41460025 CAGGGGAGCTGGAAGAGGCAGGG - Intergenic
908710032 1:67005003-67005025 TAGGTGCGATGGATAAGTGAGGG - Intronic
910072562 1:83235969-83235991 CAGATGAGCAGGAAGAGTGGTGG - Intergenic
911205713 1:95090043-95090065 AAGGGGAGCTGGAAAAGGGATGG + Intergenic
911231857 1:95370251-95370273 TAGGAGAGGTGGAAGTGTTAAGG + Intergenic
911817445 1:102371099-102371121 GAGGTGAGTTGGAAAATTGAAGG + Intergenic
912057417 1:105622465-105622487 TAGGTGAGCAGGAATAGAGTTGG + Intergenic
913203061 1:116511820-116511842 TAGGTGTGATGGAAGTGTGAGGG + Intergenic
915171971 1:153984538-153984560 TGGGAGAGCAGGAAGAGAGATGG + Intronic
915916039 1:159941661-159941683 AAGGGGAGGTGGAAGAGGGAGGG - Intronic
918627315 1:186671193-186671215 TAGGTGAGCTGGAAGATGCTTGG + Intergenic
918990501 1:191692713-191692735 GAGGGGAGCTGGAAGGGGGATGG - Intergenic
920267516 1:204735041-204735063 TAGGTTAGGTGGAGGAGGGAGGG + Intergenic
921373726 1:214451717-214451739 TAGATGAGCTGGTAGATTTAGGG - Intronic
921740787 1:218682137-218682159 TAGGTGAGGTGGAAGGGTGAAGG + Intergenic
922688768 1:227670163-227670185 TAGGAGAGTAGGAAGAGAGACGG + Intronic
922913831 1:229239558-229239580 GAGGGGAGCTGGAAAAGGGATGG + Intergenic
923911103 1:238444912-238444934 GAGGGGAGCTGGAAAAGGGATGG - Intergenic
1068194008 10:53692416-53692438 TATGTGATGGGGAAGAGTGAGGG - Intergenic
1068455284 10:57247198-57247220 TAGGAGAGCTGGGAGGGGGATGG - Intergenic
1070016931 10:72542887-72542909 AAGGCGAGCTGGAAAAGGGATGG + Intronic
1071143518 10:82540650-82540672 AAGATGAGATGGAAAAGTGATGG + Intronic
1075609841 10:123843750-123843772 TATGTTAGCTGGTACAGTGATGG - Intronic
1075793725 10:125104002-125104024 TAGCTGAACCGGAAGAGGGAAGG + Intronic
1077261609 11:1624734-1624756 TCGGTGATTAGGAAGAGTGAGGG + Intergenic
1079089382 11:17470077-17470099 TAGGTGAGGTGTAGGAGGGAGGG - Intronic
1080319547 11:30990565-30990587 AAGGTGATCTACAAGAGTGAAGG + Intronic
1080703699 11:34668152-34668174 TAGGTGAGCAAGAAGAAGGAAGG - Intergenic
1082092912 11:48104353-48104375 TGGGAGAGCAGGAAGAATGATGG + Intronic
1083968882 11:66060167-66060189 CAGGTGAGCTGGCAAAGTGAAGG - Intronic
1084095425 11:66908064-66908086 GGGGTGAGCTGGAAGAGCGGCGG + Intronic
1084752241 11:71211679-71211701 TGGGGGAGCTTGAGGAGTGATGG - Intronic
1084766493 11:71312379-71312401 AAGGTGAGCTGGAAAGGGGATGG + Intergenic
1085817872 11:79760166-79760188 TAGGTGAGCGGGAGGAGGAAAGG + Intergenic
1086001575 11:81990948-81990970 TAGGGGAGGTGGGAGGGTGAGGG + Intergenic
1086001851 11:81993082-81993104 TAGGGGAGCCGGAAGGGAGATGG - Intergenic
1087580376 11:100043698-100043720 GAGGTGAGCTTGAAGGATGAAGG - Intronic
1087608421 11:100405393-100405415 AAGGGGAGCTGGAAAAGGGATGG + Intergenic
1089093923 11:115902273-115902295 TAGGTGAGGGGTAAAAGTGAAGG - Intergenic
1090135852 11:124198752-124198774 AAGGGGAGCTGGAAGGGGGATGG - Intergenic
1091286263 11:134410274-134410296 CAGGTGAGCTGGAAGCTTGCAGG - Intronic
1092078437 12:5692726-5692748 TAGGTGGTCTGGAGGTGTGATGG + Intronic
1092521484 12:9278327-9278349 TATATGACCTGAAAGAGTGATGG + Intergenic
1092657116 12:10697847-10697869 AAAGTGAGCAGGAAGAGAGAAGG + Intergenic
1096857035 12:54490834-54490856 TAGGTAAGTTGGAAAAGGGATGG - Intergenic
1097179901 12:57165876-57165898 CAGGAGCGCTGGAAGTGTGACGG + Exonic
1098188510 12:67923720-67923742 TAATTGAGCTGGAACATTGATGG - Intergenic
1098578635 12:72072549-72072571 CACGTGATCTGTAAGAGTGAGGG + Intronic
1100861028 12:98807321-98807343 GAGGTGAGCTGGGAGAGGCACGG - Intronic
1101599604 12:106197674-106197696 TAGGTCAGCTGGAGGAGGCATGG - Intergenic
1102126413 12:110485114-110485136 TAGCTAAGCTGCAAGAGTTATGG + Exonic
1102419929 12:112795443-112795465 TTGATGTGCTGAAAGAGTGAAGG + Intronic
1104215379 12:126728390-126728412 TAGGTGAGGAGACAGAGTGACGG + Intergenic
1105241120 13:18610254-18610276 GAGGTGGGGTGGAAGAGTGGGGG + Intergenic
1105552636 13:21411721-21411743 TAGGGTAGCTAGAAGAATGACGG + Intronic
1106152416 13:27118533-27118555 TACTTGAGCTGGCAGGGTGAGGG - Intronic
1106532876 13:30610425-30610447 TAGATGAGGTGGAAGGGTGAGGG + Intronic
1107364586 13:39656200-39656222 TGTGTGAGCTGGGAGAGTGGAGG + Intronic
1107828500 13:44352553-44352575 TACGTGACCTTGAAGAGTAAGGG + Intergenic
1108753703 13:53474967-53474989 TCGGTGGGCTGGAACAGTGAGGG + Intergenic
1110175785 13:72553948-72553970 AAGGGGAGCTGGAAGGGGGATGG + Intergenic
1110711389 13:78654884-78654906 TAGGTGGACTGGAATAGTGCTGG - Intronic
1113590464 13:111495477-111495499 GAGGTGAGCTGGGAGGGTTATGG - Intergenic
1113670330 13:112171557-112171579 GAGCTGAGCTGGAAGGGTGCTGG + Intergenic
1114628273 14:24143542-24143564 TAGGGGAGGTGGATGAGTGGGGG - Intronic
1117261469 14:54038656-54038678 TAGGTAAGCTGGGAGAGAGGAGG - Intergenic
1117450564 14:55845706-55845728 AAGGGGAGCTGGAAGGGGGATGG + Intergenic
1118005674 14:61562574-61562596 TAGGTCAGCTGGAAGAGTCTTGG + Intronic
1118433419 14:65746272-65746294 TCGGTGAGCAGGAAAAGTGTTGG + Intergenic
1119513022 14:75226689-75226711 GAGGTGAGTGGGAAGAGAGAAGG + Intergenic
1124409289 15:29422645-29422667 TAGGTGAGATGGTAGAGGGTGGG - Intronic
1125404974 15:39342495-39342517 AAGATGAACTGGAAGAGTGGAGG - Intergenic
1125429568 15:39581321-39581343 TAGGCGAGCGGGGAGAGTGTAGG - Intronic
1126100185 15:45114054-45114076 CGGCGGAGCTGGAAGAGTGAGGG - Exonic
1127363209 15:58263012-58263034 TGTGTGATCTGGAAAAGTGAGGG - Intronic
1128256511 15:66201207-66201229 TAGGTGAGCTGGACTTGTGGTGG - Intronic
1130139728 15:81215426-81215448 TAGATGGTGTGGAAGAGTGATGG + Intronic
1131146949 15:90020339-90020361 TAGCAGAGCTGGAGGAGGGAAGG - Intronic
1131671773 15:94627369-94627391 GGGGTGGGCTGGAAGAGTGGGGG + Intergenic
1131956217 15:97739126-97739148 CATTTGAGCAGGAAGAGTGAGGG + Intergenic
1132234666 15:100210260-100210282 GAAGTGAGCTGGAACAGGGAGGG + Intronic
1132352149 15:101146534-101146556 GAAGGGAGCTGGAGGAGTGAGGG + Intergenic
1134871636 16:17657237-17657259 GGGGTGGGCTGGAAGAGTGAGGG + Intergenic
1135529474 16:23240222-23240244 TGGGTGAGCAGGAAGAATGCTGG - Intergenic
1135530311 16:23247351-23247373 TCAGTGAGCTGGAAGAGGAAAGG - Intergenic
1137789469 16:51162882-51162904 GAGCTGAGCTGGGAGTGTGAAGG - Intergenic
1138515129 16:57531726-57531748 AAGGTGAGCTGGGAAAGAGAGGG - Intronic
1139768593 16:69253973-69253995 TAGGTCAGTAGGAGGAGTGAAGG + Intronic
1140950117 16:79808826-79808848 TCAGTGAGCTGGCCGAGTGAAGG - Intergenic
1141492472 16:84383392-84383414 TTGGTGAGATAGAGGAGTGAAGG + Intronic
1143125497 17:4639062-4639084 AAGAAGAGCTGGAAGAGAGAAGG - Exonic
1143402974 17:6657750-6657772 AAGAGGAGCTGGAAGAGAGAAGG + Intergenic
1143407259 17:6685755-6685777 AAGGTGAGCTGGAAGGGACATGG + Exonic
1143830463 17:9646353-9646375 GGGGTGAGCTGGCAGATTGAAGG + Intronic
1146513224 17:33468829-33468851 TTGCTGAGCTTGCAGAGTGAAGG + Intronic
1147591771 17:41688671-41688693 TAGGAGAGCTGGGAGGGGGAGGG - Intergenic
1147655460 17:42088312-42088334 TGGGGGTGCTGGAAGAGAGAAGG - Intergenic
1147727207 17:42573458-42573480 CAGGTGAGCTGGAAGGCTGTAGG - Exonic
1147793551 17:43027504-43027526 TAGGGGAGGTGGGGGAGTGAAGG + Intronic
1147889590 17:43707939-43707961 GAAGTGACCTGGTAGAGTGAGGG + Intergenic
1150198163 17:63323099-63323121 TAGGTGAGCAGCAAGATTGCAGG - Intronic
1151533200 17:74720888-74720910 AAGGGGAGCTGGAAAAGGGATGG + Intronic
1151872947 17:76848978-76849000 TAGCTGAGGAGGAAGAGAGAAGG + Intergenic
1152122649 17:78428224-78428246 TAGGGAAGCTGGAAGACTGCAGG + Intronic
1156967743 18:43115750-43115772 TAGGAGACGTGAAAGAGTGAAGG - Intergenic
1158811215 18:61037998-61038020 TAGATAAACTGGAAGAATGAAGG + Intergenic
1158827810 18:61243156-61243178 TAGGTGAGTGGGAAGACTAAGGG - Intergenic
1159966594 18:74601081-74601103 TAGGTGAGATGGACAAGTCAAGG + Intronic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1165251570 19:34540785-34540807 TAGGTGGGCTGTAAAAGTAATGG + Intergenic
1166047639 19:40238809-40238831 TGGGTGAGATGGAAGGGTGGAGG - Intronic
1166707286 19:44914978-44915000 TTGGAGATTTGGAAGAGTGAAGG + Intronic
1166709390 19:44927062-44927084 TTGGAGATTTGGAAGAGTGAAGG + Intergenic
1168126896 19:54289193-54289215 TGGGTGAGCTGAAGGAGAGAGGG - Intergenic
924997591 2:377203-377225 CAGGTTTGGTGGAAGAGTGACGG - Intergenic
925408367 2:3624258-3624280 TTGGGGAGCTGGCAGAGTGTTGG + Intronic
927633388 2:24793499-24793521 TGGGTGAGCTAGAAGGGAGAAGG + Exonic
928062386 2:28127686-28127708 GAGTTGAGCAGGATGAGTGATGG + Intronic
928170825 2:29002024-29002046 GAGGGGAGCTGGAAGTGTGGCGG + Intronic
929583167 2:43097277-43097299 TAGGTGAAGTGGGAGAGAGAGGG + Intergenic
930585275 2:53260392-53260414 TAGGTGAGGTGGATGAGAGGTGG - Intergenic
932083178 2:68733645-68733667 TAGGTGAGCAGATAGAGTGAGGG + Intronic
932644918 2:73490100-73490122 TCGGTGAGATGAAAAAGTGATGG - Exonic
934902554 2:98172244-98172266 TAGGGGAGCTAGAAGGGTGATGG + Intronic
934907973 2:98222265-98222287 AAGGTGAGCTGTCAGAGTGGTGG - Intronic
935189061 2:100761314-100761336 TAGTAGAGCAGGAAGAGTCAAGG - Intergenic
937245709 2:120491276-120491298 TAGGAGAGCAGGAGGAGTCAGGG - Intergenic
937325022 2:120985230-120985252 TGGGTGGGCTGGGGGAGTGAGGG + Intronic
938016727 2:127873449-127873471 CAGGTGAGTTGGAAGTCTGAGGG - Intronic
939661395 2:144895090-144895112 AAGGTGATCAGGAAGAGAGAGGG - Intergenic
941638642 2:167962957-167962979 CAGGAGAGCTGGAGGAGTGGGGG + Intronic
942298486 2:174539482-174539504 TAGGTGGGGAGGAAGAGGGAGGG + Intergenic
942672971 2:178396392-178396414 GAGGTTAGGTGGAAGAGGGATGG - Intronic
942704312 2:178751701-178751723 TCTCTAAGCTGGAAGAGTGATGG + Intronic
942757137 2:179355031-179355053 TAGGTGATCTGAAAGAGAAATGG + Intergenic
944440090 2:199733569-199733591 TAGGAAAGCAGGAAGAGAGATGG + Intergenic
945070020 2:205980204-205980226 TAGGAGAGGGAGAAGAGTGAAGG + Intergenic
947588532 2:231371386-231371408 CAGGTGACCTGGGAGAGGGAAGG + Intronic
948594151 2:239068634-239068656 TGGGTCAGCTGAAAGAGGGACGG + Intronic
948708428 2:239810251-239810273 TAGATGACATGGAAGAGTTAAGG - Intergenic
1170012040 20:11734765-11734787 CTGGTGAGATGGATGAGTGAGGG + Intergenic
1170140988 20:13124779-13124801 TAAGAGAGATGGAAAAGTGATGG + Intronic
1170172547 20:13431598-13431620 GAGGTGAGGTAGGAGAGTGAAGG + Intronic
1170656658 20:18293066-18293088 CAGGTAAGCTGAAAGAGAGAGGG + Intronic
1171395080 20:24827675-24827697 TGAGAGAGCTGGAAGAGTGCAGG + Intergenic
1176042450 20:63072566-63072588 GAGGTTAGGTGGATGAGTGAAGG + Intergenic
1178222914 21:30681351-30681373 TGGGTGAGCAGGAAGAGTAGAGG + Intergenic
1178471504 21:32897628-32897650 TAGGGGAACTGGATGAGTGCAGG + Intergenic
1178932187 21:36829130-36829152 TAAGTGAGCAGGAGGAGAGATGG - Intronic
1179016768 21:37600603-37600625 TGGGAGAGCTGGAGGAGAGAAGG + Intergenic
1179236474 21:39551768-39551790 TTGGTCAGCTGGTAGAGGGAGGG + Intergenic
1179240052 21:39581937-39581959 TAGGTGTGCTGGCAGAATAATGG + Intronic
1180675860 22:17586108-17586130 GAGGTGACCTGGAAGCCTGAGGG + Intronic
1181531390 22:23519364-23519386 GAGGTGAGCAGGAAGAGCGGGGG + Intergenic
1182757906 22:32695661-32695683 GAGGTGAGGTGGAAGAGAAAGGG - Intronic
1184340039 22:43881030-43881052 TGGCTGAGCTGGAAGTGTCAGGG + Intronic
949373875 3:3365442-3365464 TAGGTGAGGAAGAACAGTGAGGG + Intergenic
950719166 3:14870357-14870379 TAAGGGAGGTGGAGGAGTGAGGG - Intronic
951847135 3:27096751-27096773 TTTGTGAACTGAAAGAGTGAGGG + Intergenic
951881769 3:27486483-27486505 TGGGAGAGCTGGCAGAGGGAAGG - Intergenic
952153254 3:30615368-30615390 TATGTGAGCTGTAAGATTCAGGG - Intronic
953150940 3:40323904-40323926 TAGCTGAACTGGAAGAGACATGG - Intergenic
953249667 3:41233153-41233175 GAGGTGAACTGGCAAAGTGAAGG + Intronic
954126942 3:48536891-48536913 CAGCTGACCAGGAAGAGTGAGGG - Intronic
955817525 3:62861139-62861161 TAGGTCAGCTGGAAGCCAGATGG + Intronic
956292857 3:67679612-67679634 CAGGTGGGCAGGAAGAGTGTGGG + Intergenic
957136650 3:76296826-76296848 TAGGTGAGCGGGTAGCTTGATGG + Intronic
959123568 3:102262990-102263012 TTGGGGAGGTGGATGAGTGATGG + Intronic
961531897 3:127545031-127545053 TGGGTGAGCAGGAAGAGGAAGGG + Intergenic
961555301 3:127692946-127692968 AAGGTGACCAGGGAGAGTGAAGG - Intronic
964691013 3:159449852-159449874 TAAGTGAGCTTGAAGCATGAAGG + Intronic
964847234 3:161057259-161057281 TAGGTGAGGCGGAGGAGGGAAGG - Intronic
966072851 3:175900411-175900433 CAGGTGTCCTGGAAGCGTGAAGG - Intergenic
966797264 3:183727507-183727529 TTCATGAGCTGGAAGAGTAAAGG + Intronic
967999568 3:195195640-195195662 TAGGGGAACTGCCAGAGTGAAGG - Intronic
968793820 4:2688547-2688569 TTGGTGAGCAGGAAGGGTGGAGG + Intronic
969120758 4:4909307-4909329 TAGGTGCTCAGGAAAAGTGATGG - Intergenic
970118249 4:12723428-12723450 TAAATGAGCTGGAAGACTGTGGG - Intergenic
970858548 4:20676032-20676054 CATGTGAGCTGGAAGTGAGAAGG - Intergenic
971730289 4:30370379-30370401 AAGGAGAGCTGGAAAAGGGATGG - Intergenic
972784387 4:42313588-42313610 TAGGTAATCTGAATGAGTGAGGG - Intergenic
973665845 4:53158473-53158495 TTGGTCAACTGGAAGAGTGATGG - Intronic
975867462 4:78738598-78738620 TAGATGCTCTGGAAAAGTGAGGG + Intergenic
976623775 4:87156369-87156391 GAGGTGGGGTGGAAGAGTGGAGG + Intergenic
978226486 4:106340900-106340922 TTGGTGAGGTGGAAGAGAAAAGG - Intronic
979392256 4:120141143-120141165 ATGGAGAGCTGGAAGAGGGATGG - Intergenic
979908943 4:126335367-126335389 TGGGTGAGTTGGCACAGTGAAGG - Intergenic
981195396 4:141914171-141914193 TTGGTGATCTGGAAAATTGAGGG - Intergenic
984245934 4:177275333-177275355 AAGGGGAGCTGGAAGGGGGATGG - Intergenic
985097997 4:186431685-186431707 CAGGTCTGCTGGAAGAGTGGAGG + Intronic
986728222 5:10615873-10615895 TAGGTTAGCTGGGAGAATGGAGG + Intronic
988231359 5:28483836-28483858 AAGGAGAGCTGGAAAGGTGATGG + Intergenic
988821035 5:34885995-34886017 TAGGTGAACAAAAAGAGTGAGGG + Intronic
989719123 5:44504014-44504036 TTGGGGAGCTGGAAGGGGGATGG - Intergenic
992992494 5:82298432-82298454 ATGGGGAGCTGGAAGGGTGATGG + Intronic
992995461 5:82328401-82328423 TAGGTGAGCTGGAAGAGGTGGGG - Intronic
994072100 5:95614032-95614054 GAGGAGAGCTGGAACAGAGAGGG + Intergenic
994423325 5:99550534-99550556 TATGTCAGCTGTAAGATTGAAGG + Intergenic
996052183 5:118947384-118947406 AAGGAGAGCTGGAAGAGGGATGG + Intronic
996405251 5:123097905-123097927 CAAGAGAGCTGGAAGAATGAGGG - Intronic
996647689 5:125836173-125836195 TAGGTGAGCTGGAAAAATAGAGG - Intergenic
997579880 5:135010589-135010611 CAGGTGCCCTGGGAGAGTGAAGG + Intronic
998224606 5:140316967-140316989 TAGGTGACCAGGCAGAGTGCAGG - Intergenic
998251189 5:140554117-140554139 TAGCTGAGCTGGAAGGGGTAAGG - Intronic
999431248 5:151527250-151527272 TAGTTGAGCTGGAAGAATCTCGG + Exonic
999684504 5:154090172-154090194 CAGGTGAGCTGGAAGCTTAAAGG - Intronic
1000742958 5:164993431-164993453 TAGGTGGCCAGGAAGTGTGAAGG + Intergenic
1000781963 5:165493355-165493377 TGGGTGAGAGGGAAGAGTAATGG + Intergenic
1001602165 5:172935968-172935990 TAGCTGAGGTGGAAGAGACAGGG + Intronic
1003024304 6:2540018-2540040 TTGGTGACCTCAAAGAGTGATGG + Intergenic
1003050532 6:2777028-2777050 TAGGTTAGCTGTAAGGTTGATGG + Intronic
1004618335 6:17311624-17311646 CAGGTGAGCTTGAAAAGGGAGGG - Intergenic
1004637983 6:17487054-17487076 GAGGTGAGCAAGAAAAGTGATGG - Intronic
1006923540 6:37641354-37641376 GAGGTGAGCTGGAAGGGACAGGG + Intronic
1007326087 6:41061043-41061065 ATGTTGTGCTGGAAGAGTGATGG + Intronic
1008011310 6:46470620-46470642 TAAGTGAACTGGTAGAGAGAGGG - Intronic
1009625268 6:66131842-66131864 TAGCTGAAGAGGAAGAGTGATGG - Intergenic
1009823425 6:68835585-68835607 AATTTGAGCTGGAAGAGTCAGGG - Intronic
1012547030 6:100431873-100431895 TAGTAGGGCTGGATGAGTGATGG + Intronic
1012634377 6:101517397-101517419 TAGCTCAGCTGGTAGAGCGAAGG + Intronic
1013307687 6:108864722-108864744 TGGGTGATCTGGAAGAGCCAGGG + Intronic
1014252209 6:119126848-119126870 AAGGGGAGCTGGAAAAGGGATGG + Intronic
1014553169 6:122812300-122812322 TAGGTGAGTAGGAAGATTTAAGG + Intergenic
1015295894 6:131591876-131591898 CATGTGAGCTGGAAAAGTCAGGG + Intronic
1015431164 6:133131693-133131715 CAGGGGCGCTGGAAGATTGATGG + Intergenic
1015744366 6:136494164-136494186 TAGGTAGGCTGCAAGACTGAAGG - Intronic
1018831086 6:167444115-167444137 AAGGGGAGCTGGAAGTGGGATGG + Intergenic
1022469281 7:30672214-30672236 TTGGGGAGCTGGAACAGTCATGG - Intronic
1022542026 7:31146413-31146435 GAGAGGAGATGGAAGAGTGAAGG - Intergenic
1022742202 7:33133404-33133426 TAGGGGAGAAGGAAGAGAGAAGG - Intronic
1022746496 7:33178168-33178190 CAGGGCAGCTGGAAGAGTGGGGG + Intronic
1023572989 7:41591949-41591971 AAGGTGAGCTGGAAGAATCCTGG - Intergenic
1023612102 7:41981618-41981640 TAGGTGAGGTGGCAAAGGGAGGG + Intronic
1023763843 7:43492366-43492388 TAGGTGAGGAGGAAGGGAGAGGG - Intronic
1026810932 7:73464177-73464199 TAGGTTTGATGGAAGAGAGAAGG - Intronic
1027290284 7:76701117-76701139 CAGATGAGCAGGAAGAGTGGTGG - Intergenic
1027709964 7:81587845-81587867 TAGGTTAGCTGGAAGATAAATGG - Intergenic
1029507110 7:100969123-100969145 AAGGTTGGCTGGAAGAGAGAGGG + Intergenic
1030398878 7:109023176-109023198 TAAGTGAACTGTAAGAGTCATGG + Intergenic
1032379918 7:131468010-131468032 AGGGTGAGCAAGAAGAGTGAAGG + Intronic
1034704757 7:153130674-153130696 TAGGTGAGAAGGGAGGGTGAGGG - Intergenic
1034856089 7:154548622-154548644 TACGTGTGATGGAGGAGTGATGG - Intronic
1040425819 8:47284947-47284969 TGGGTGTGTAGGAAGAGTGAGGG + Intronic
1041328478 8:56696262-56696284 TATGTGAGATGGAAGAGAAAGGG + Intergenic
1041993748 8:64027805-64027827 TAGGTGATGTGGGAGAGAGAAGG - Intergenic
1042601441 8:70503192-70503214 ATGGGAAGCTGGAAGAGTGATGG + Intergenic
1044781278 8:95745782-95745804 TAGGTTTGCTGTAAGAGTGTTGG - Intergenic
1045280052 8:100742331-100742353 CAGGTGGGCAGGAAGAATGATGG + Intergenic
1046601645 8:116324179-116324201 TAGGTGATCTAGAAGAATGGTGG + Intergenic
1048056806 8:130874778-130874800 AGGGTGAGCTGGAAGAATGGTGG - Intronic
1049339276 8:142103314-142103336 TGGGTGTGGTGGAAGAGTCAGGG - Intergenic
1050365500 9:4869924-4869946 TAGGTGAGTTTGAACAGTGCAGG - Intronic
1051403672 9:16710741-16710763 TAGGTGAGTTGGGAGGGGGAGGG - Intronic
1051411878 9:16798077-16798099 TTGTTGATCTGGAAGTGTGAAGG + Intronic
1051898412 9:22012392-22012414 TAGGTGAGCTGGAAGAGTGAAGG - Intronic
1053330193 9:37198821-37198843 TAGGATAGGTGGTAGAGTGAAGG + Intronic
1053466654 9:38313356-38313378 TAGCTCAGCTGGAAAAGGGAAGG - Intergenic
1056825524 9:89874008-89874030 CAGGTGAGCTGGGAGAGACAAGG - Intergenic
1057041777 9:91853333-91853355 CAGGTGAGGTGGAAGAAGGAGGG + Intronic
1057164312 9:92914155-92914177 AAGAGGAGCTGGAAGAGAGAAGG + Intergenic
1057928587 9:99173787-99173809 GAGGTTAGGTGGAGGAGTGAGGG + Intergenic
1058609135 9:106756058-106756080 CAGGTGATCTGGAAGAGGGTGGG - Intergenic
1058818009 9:108703422-108703444 GAGGCCAGCTGGAAGAGTGGAGG + Intergenic
1059086358 9:111306923-111306945 TACGTTAGCTGGAAGGGTGTAGG - Intergenic
1059318838 9:113450513-113450535 TAGGTGAGCAGTCAGAGAGAAGG + Intronic
1061783218 9:133007945-133007967 GAGGTGGGGAGGAAGAGTGAGGG - Intergenic
1185950106 X:4423043-4423065 AAGGGGAGCTGGAAGTGGGATGG + Intergenic
1186108593 X:6231442-6231464 TATGTGACCTGGAAGAGAGCAGG + Intergenic
1187319334 X:18226280-18226302 CAGGGGAGCTGGAGGAGGGAAGG + Intergenic
1189209016 X:39267085-39267107 TTGGTGAGCTTAAAGAGTGTGGG - Intergenic
1191767117 X:64710013-64710035 AAGGGGAGCTGGAAGGGGGATGG + Intergenic
1192081947 X:68056786-68056808 TAGGTTAAATGGTAGAGTGAGGG + Intronic
1192197447 X:69038078-69038100 GAGGTAAGCTGGAAGATAGAGGG - Intergenic
1193183624 X:78486896-78486918 TAGGGGAGCCAGAAGAGAGATGG + Intergenic
1195366541 X:104131978-104132000 TAGGAGAGATGGTAGAGTTAAGG - Intronic
1195858765 X:109358480-109358502 AAGGGGAGCTGGAAGAGGGATGG - Intergenic
1197332733 X:125174067-125174089 AAGGGTAGCTGGAAGAATGATGG + Intergenic
1197432387 X:126382825-126382847 TAGGGAAGATGCAAGAGTGAAGG + Intergenic
1197983555 X:132243962-132243984 TTAGAGAGCTGGAATAGTGAAGG + Intergenic
1199381915 X:147181373-147181395 TGGGTAAGGTGGAAGAGGGAGGG + Intergenic
1201972974 Y:19816421-19816443 GGGGGCAGCTGGAAGAGTGAGGG + Intergenic