ID: 1051902095

View in Genome Browser
Species Human (GRCh38)
Location 9:22054763-22054785
Sequence TTTACTTTATTTGTTGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051902094_1051902095 -4 Left 1051902094 9:22054744-22054766 CCTTTTTATTTTTATTTATTTTA No data
Right 1051902095 9:22054763-22054785 TTTACTTTATTTGTTGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051902095 Original CRISPR TTTACTTTATTTGTTGTTGC TGG Intergenic
No off target data available for this crispr