ID: 1051912518

View in Genome Browser
Species Human (GRCh38)
Location 9:22170676-22170698
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051912518_1051912525 22 Left 1051912518 9:22170676-22170698 CCAAGATGGCCATCCTAATTAGT No data
Right 1051912525 9:22170721-22170743 AAGTTCCCCCAAAGTGATCAGGG No data
1051912518_1051912522 -9 Left 1051912518 9:22170676-22170698 CCAAGATGGCCATCCTAATTAGT No data
Right 1051912522 9:22170690-22170712 CTAATTAGTCATAGGCACCAAGG No data
1051912518_1051912524 21 Left 1051912518 9:22170676-22170698 CCAAGATGGCCATCCTAATTAGT No data
Right 1051912524 9:22170720-22170742 CAAGTTCCCCCAAAGTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051912518 Original CRISPR ACTAATTAGGATGGCCATCT TGG (reversed) Intergenic
No off target data available for this crispr