ID: 1051912521

View in Genome Browser
Species Human (GRCh38)
Location 9:22170689-22170711
Sequence CTTGGTGCCTATGACTAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051912521_1051912524 8 Left 1051912521 9:22170689-22170711 CCTAATTAGTCATAGGCACCAAG No data
Right 1051912524 9:22170720-22170742 CAAGTTCCCCCAAAGTGATCAGG No data
1051912521_1051912525 9 Left 1051912521 9:22170689-22170711 CCTAATTAGTCATAGGCACCAAG No data
Right 1051912525 9:22170721-22170743 AAGTTCCCCCAAAGTGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051912521 Original CRISPR CTTGGTGCCTATGACTAATT AGG (reversed) Intergenic
No off target data available for this crispr