ID: 1051912524

View in Genome Browser
Species Human (GRCh38)
Location 9:22170720-22170742
Sequence CAAGTTCCCCCAAAGTGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051912518_1051912524 21 Left 1051912518 9:22170676-22170698 CCAAGATGGCCATCCTAATTAGT No data
Right 1051912524 9:22170720-22170742 CAAGTTCCCCCAAAGTGATCAGG No data
1051912521_1051912524 8 Left 1051912521 9:22170689-22170711 CCTAATTAGTCATAGGCACCAAG No data
Right 1051912524 9:22170720-22170742 CAAGTTCCCCCAAAGTGATCAGG No data
1051912523_1051912524 -10 Left 1051912523 9:22170707-22170729 CCAAGGTGTTTCTCAAGTTCCCC No data
Right 1051912524 9:22170720-22170742 CAAGTTCCCCCAAAGTGATCAGG No data
1051912520_1051912524 12 Left 1051912520 9:22170685-22170707 CCATCCTAATTAGTCATAGGCAC No data
Right 1051912524 9:22170720-22170742 CAAGTTCCCCCAAAGTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051912524 Original CRISPR CAAGTTCCCCCAAAGTGATC AGG Intergenic
No off target data available for this crispr