ID: 1051919608

View in Genome Browser
Species Human (GRCh38)
Location 9:22249976-22249998
Sequence TTTTTAGCTGTGTCCTTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051919607_1051919608 -10 Left 1051919607 9:22249963-22249985 CCTGTAGTTTTCTTTTTTAGCTG No data
Right 1051919608 9:22249976-22249998 TTTTTAGCTGTGTCCTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051919608 Original CRISPR TTTTTAGCTGTGTCCTTGCC AGG Intergenic
No off target data available for this crispr