ID: 1051923863

View in Genome Browser
Species Human (GRCh38)
Location 9:22299480-22299502
Sequence GGGTGATGCCAGAACTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051923856_1051923863 8 Left 1051923856 9:22299449-22299471 CCATAGGCTGTTCAGTCTGGGAA No data
Right 1051923863 9:22299480-22299502 GGGTGATGCCAGAACTCTCTTGG No data
1051923855_1051923863 9 Left 1051923855 9:22299448-22299470 CCCATAGGCTGTTCAGTCTGGGA No data
Right 1051923863 9:22299480-22299502 GGGTGATGCCAGAACTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051923863 Original CRISPR GGGTGATGCCAGAACTCTCT TGG Intergenic
No off target data available for this crispr