ID: 1051925709

View in Genome Browser
Species Human (GRCh38)
Location 9:22322467-22322489
Sequence TCTTCTCTTCTGAAGCTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051925706_1051925709 22 Left 1051925706 9:22322422-22322444 CCACATAAACGATATAAAAACTT No data
Right 1051925709 9:22322467-22322489 TCTTCTCTTCTGAAGCTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051925709 Original CRISPR TCTTCTCTTCTGAAGCTACA GGG Intergenic
No off target data available for this crispr