ID: 1051934349

View in Genome Browser
Species Human (GRCh38)
Location 9:22427057-22427079
Sequence ATGTAGTTAAAGAGGAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051934347_1051934349 -10 Left 1051934347 9:22427044-22427066 CCTGATAGACTACATGTAGTTAA No data
Right 1051934349 9:22427057-22427079 ATGTAGTTAAAGAGGAGAGCAGG No data
1051934345_1051934349 10 Left 1051934345 9:22427024-22427046 CCATCTGCCAGTGTGTGAAACCT No data
Right 1051934349 9:22427057-22427079 ATGTAGTTAAAGAGGAGAGCAGG No data
1051934346_1051934349 3 Left 1051934346 9:22427031-22427053 CCAGTGTGTGAAACCTGATAGAC No data
Right 1051934349 9:22427057-22427079 ATGTAGTTAAAGAGGAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051934349 Original CRISPR ATGTAGTTAAAGAGGAGAGC AGG Intergenic
No off target data available for this crispr