ID: 1051934839

View in Genome Browser
Species Human (GRCh38)
Location 9:22434147-22434169
Sequence GTGTTTACAAACTTTTAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051934839_1051934843 13 Left 1051934839 9:22434147-22434169 CCTAGCTAAAAGTTTGTAAACAC No data
Right 1051934843 9:22434183-22434205 CTGTGTCTAGCTAATTGGGTAGG 0: 39
1: 49
2: 194
3: 978
4: 1727
1051934839_1051934844 14 Left 1051934839 9:22434147-22434169 CCTAGCTAAAAGTTTGTAAACAC No data
Right 1051934844 9:22434184-22434206 TGTGTCTAGCTAATTGGGTAGGG No data
1051934839_1051934841 8 Left 1051934839 9:22434147-22434169 CCTAGCTAAAAGTTTGTAAACAC No data
Right 1051934841 9:22434178-22434200 GCACTCTGTGTCTAGCTAATTGG 0: 28
1: 38
2: 57
3: 52
4: 78
1051934839_1051934842 9 Left 1051934839 9:22434147-22434169 CCTAGCTAAAAGTTTGTAAACAC No data
Right 1051934842 9:22434179-22434201 CACTCTGTGTCTAGCTAATTGGG 0: 13
1: 93
2: 617
3: 1085
4: 1260
1051934839_1051934845 15 Left 1051934839 9:22434147-22434169 CCTAGCTAAAAGTTTGTAAACAC No data
Right 1051934845 9:22434185-22434207 GTGTCTAGCTAATTGGGTAGGGG No data
1051934839_1051934846 21 Left 1051934839 9:22434147-22434169 CCTAGCTAAAAGTTTGTAAACAC No data
Right 1051934846 9:22434191-22434213 AGCTAATTGGGTAGGGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051934839 Original CRISPR GTGTTTACAAACTTTTAGCT AGG (reversed) Intergenic
No off target data available for this crispr