ID: 1051936234

View in Genome Browser
Species Human (GRCh38)
Location 9:22446697-22446719
Sequence GTGGGGACCTTCTGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 404}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051936234_1051936254 14 Left 1051936234 9:22446697-22446719 CCCTCCTCCCAGAAGGTCCCCAC 0: 1
1: 0
2: 3
3: 29
4: 404
Right 1051936254 9:22446734-22446756 CCTCCCCCGGCTTCCGCGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 129
1051936234_1051936252 13 Left 1051936234 9:22446697-22446719 CCCTCCTCCCAGAAGGTCCCCAC 0: 1
1: 0
2: 3
3: 29
4: 404
Right 1051936252 9:22446733-22446755 CCCTCCCCCGGCTTCCGCGCTGG 0: 1
1: 0
2: 1
3: 18
4: 224
1051936234_1051936240 -10 Left 1051936234 9:22446697-22446719 CCCTCCTCCCAGAAGGTCCCCAC 0: 1
1: 0
2: 3
3: 29
4: 404
Right 1051936240 9:22446710-22446732 AGGTCCCCACTCCCCGCCCCGGG 0: 1
1: 0
2: 10
3: 43
4: 407
1051936234_1051936259 19 Left 1051936234 9:22446697-22446719 CCCTCCTCCCAGAAGGTCCCCAC 0: 1
1: 0
2: 3
3: 29
4: 404
Right 1051936259 9:22446739-22446761 CCCGGCTTCCGCGCTGGGCCGGG 0: 1
1: 0
2: 1
3: 26
4: 242
1051936234_1051936245 1 Left 1051936234 9:22446697-22446719 CCCTCCTCCCAGAAGGTCCCCAC 0: 1
1: 0
2: 3
3: 29
4: 404
Right 1051936245 9:22446721-22446743 CCCCGCCCCGGGCCCTCCCCCGG 0: 1
1: 2
2: 20
3: 213
4: 1347
1051936234_1051936264 30 Left 1051936234 9:22446697-22446719 CCCTCCTCCCAGAAGGTCCCCAC 0: 1
1: 0
2: 3
3: 29
4: 404
Right 1051936264 9:22446750-22446772 CGCTGGGCCGGGAGCCTGGGTGG 0: 1
1: 0
2: 2
3: 55
4: 453
1051936234_1051936261 26 Left 1051936234 9:22446697-22446719 CCCTCCTCCCAGAAGGTCCCCAC 0: 1
1: 0
2: 3
3: 29
4: 404
Right 1051936261 9:22446746-22446768 TCCGCGCTGGGCCGGGAGCCTGG 0: 1
1: 0
2: 0
3: 26
4: 311
1051936234_1051936257 18 Left 1051936234 9:22446697-22446719 CCCTCCTCCCAGAAGGTCCCCAC 0: 1
1: 0
2: 3
3: 29
4: 404
Right 1051936257 9:22446738-22446760 CCCCGGCTTCCGCGCTGGGCCGG 0: 1
1: 0
2: 1
3: 16
4: 191
1051936234_1051936263 27 Left 1051936234 9:22446697-22446719 CCCTCCTCCCAGAAGGTCCCCAC 0: 1
1: 0
2: 3
3: 29
4: 404
Right 1051936263 9:22446747-22446769 CCGCGCTGGGCCGGGAGCCTGGG 0: 1
1: 0
2: 0
3: 24
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051936234 Original CRISPR GTGGGGACCTTCTGGGAGGA GGG (reversed) Intergenic
900587545 1:3440431-3440453 GTGGGGAGCTTCAGGGAGTGGGG - Intergenic
900636797 1:3669837-3669859 GTGGGGATTTGCTGTGAGGAGGG + Intronic
901064306 1:6487489-6487511 GTGCGGACCAGCTGGGAGGGAGG - Intronic
901128067 1:6943214-6943236 GTGAGGACGGTCAGGGAGGAGGG - Intronic
903115417 1:21175879-21175901 GAGGGTACCTTAGGGGAGGAGGG + Intronic
903241801 1:21987612-21987634 GTGGTGACCTCCTGGGAGTGGGG + Intronic
903245309 1:22010781-22010803 GTGGTGACCTCCTGGGAGTGGGG + Intronic
904714617 1:32457968-32457990 ATGGTGATCTTCTGGGAGCAGGG + Intergenic
904917493 1:33980879-33980901 GTGGGGAACTTCCAGAAGGAGGG + Intronic
905146055 1:35887525-35887547 GTCTGGACCTTCTGTGTGGAAGG + Intronic
905774769 1:40661511-40661533 GTGGGGTCCTTCTAGGCGCAGGG + Intronic
905973384 1:42157352-42157374 GCTGGGAACTTCTGGGAGCAGGG + Intergenic
906609677 1:47192703-47192725 GTGAAGACCTCCAGGGAGGAGGG - Intergenic
906703362 1:47876078-47876100 GAGTGGACCTTCTGGGAGGCTGG - Intronic
907437661 1:54459788-54459810 GTTGGGGCCTCCTGGGAGGATGG + Intergenic
907836202 1:58111019-58111041 TTAGGGCCCTTCTGGGAGGGTGG + Intronic
908227704 1:62072578-62072600 ATGGTGACCTCCTGGGAGGAGGG + Intronic
909890572 1:81001328-81001350 GTGTGGTCCATCTGGGAGGCAGG + Intergenic
910214503 1:84829499-84829521 GTGGGATCCTTCTGCTAGGAAGG + Intronic
910262306 1:85304294-85304316 GAGGGGCCCTTCTGAGGGGAGGG + Intergenic
910275514 1:85445289-85445311 GTGGGGTGCTTCAAGGAGGAGGG + Intronic
910926408 1:92402533-92402555 ATGGTGACCTCCTGGGAGCATGG - Intergenic
913392883 1:118333920-118333942 TTGGGGACCCTCTGGGATGAAGG + Intergenic
915101054 1:153500606-153500628 ATGGTGACCTCCTGGGAGCAGGG - Intergenic
915601885 1:156927671-156927693 GGAGGGACCTGCTGGGAGCAGGG + Intronic
916269381 1:162923399-162923421 CTGGGGACCTTCTGTTAAGATGG - Intergenic
916881394 1:169022684-169022706 GTTGGGAACTACTGGGAGAAAGG - Intergenic
916961002 1:169889717-169889739 ATGAGGAACTTTTGGGAGGATGG + Intronic
918125612 1:181580790-181580812 GTGGGGACCTGGAAGGAGGAGGG + Intronic
918245025 1:182651735-182651757 GTGGGGATCTCCTGGCAGGCAGG - Intronic
918247854 1:182675624-182675646 GTGGGGACATTCCGGGCAGAAGG - Intronic
919462311 1:197892295-197892317 GTTGGGAACTGCTGGGAGAAGGG + Intergenic
919469211 1:197957998-197958020 GTGGGGAAGCTGTGGGAGGAAGG + Intergenic
922509681 1:226153780-226153802 CTGGGGACCATCTTGGAGGCTGG - Intronic
922776187 1:228215190-228215212 ATGGGGACCTTCTGTGGGGAGGG + Intronic
922862943 1:228834868-228834890 GGTGGGAGCTTCTGGGAGTATGG + Intergenic
1063923275 10:10952246-10952268 GTGCGGAACTTCAGGGGGGAAGG - Intergenic
1065020026 10:21495937-21495959 GTGGGGACGCTGGGGGAGGAAGG + Exonic
1066616204 10:37297524-37297546 ATGGTGACCTCCTGGGAGCAGGG + Intronic
1067089982 10:43261620-43261642 GAGTGGACCAGCTGGGAGGATGG - Intronic
1067463957 10:46480035-46480057 GTGGGGTCCTTCAAGGAGCAGGG - Intergenic
1067623238 10:47904616-47904638 GTGGGGTCCTTCAAGGAGCAGGG + Intergenic
1068601311 10:58959820-58959842 GAGGGAATCTTCTGGGATGATGG - Intergenic
1069051981 10:63804397-63804419 TTGGGGTCCATCTGGGAGCATGG + Intergenic
1069945908 10:71985427-71985449 GTGGGGACTTTCTGAGGGAAAGG - Intronic
1070061184 10:72984462-72984484 ATGGGGCTCTTCTGGGGGGATGG + Intergenic
1071533712 10:86409951-86409973 GAGGGAAACTTCTGGGATGATGG + Intergenic
1073669400 10:105570798-105570820 GGAGGGACCCTATGGGAGGATGG - Intergenic
1073983280 10:109178799-109178821 GAGTAGGCCTTCTGGGAGGAAGG + Intergenic
1074713793 10:116199839-116199861 GAGGGAATCTTCTGGGATGATGG - Intronic
1075922739 10:126226373-126226395 GTGAGGAGCTTCTGTGTGGAGGG + Intronic
1076120705 10:127934788-127934810 GTGGGAACTTGCTGGAAGGAAGG + Intronic
1076317401 10:129552121-129552143 AGGGGGACCTGCTGAGAGGAAGG + Intronic
1076694788 10:132242255-132242277 GCTGGGAGCTGCTGGGAGGAGGG + Intronic
1076751480 10:132545587-132545609 GTGGGGGCCTTAGGGGAAGAGGG + Intronic
1077184280 11:1229386-1229408 GGTGGGACCTTCTGGCATGAGGG - Intronic
1078196188 11:9138745-9138767 GTTGGGTCCATCTGTGAGGATGG - Intergenic
1081538706 11:44014665-44014687 GTAGGGTCCATCTTGGAGGATGG + Intergenic
1081660025 11:44882344-44882366 GTGGAGACCCGCTGGGAGCAGGG - Intronic
1081719079 11:45273438-45273460 GTGGGGGCCTTCTGGGGCCAGGG + Intronic
1081910555 11:46697288-46697310 GTGGGGAGCTTGTGGCAGGAGGG - Intronic
1082028200 11:47587677-47587699 GAGGGGCACTTCTGGGAGGCTGG + Intronic
1083227836 11:61295614-61295636 GTGCAGACCTTCTGGCAGGCTGG - Intergenic
1084067387 11:66712860-66712882 CTGGTGACCTCCTGGGAGCAGGG - Intronic
1084157190 11:67320358-67320380 ATGGTGAGCTTCTGGGAGGCAGG + Intronic
1084286935 11:68137845-68137867 GTGGGGAGTTTCTGGAAGCAAGG - Intergenic
1085757413 11:79213163-79213185 GTGGGGACATTCCAGGAGGAAGG + Intronic
1086091004 11:83004687-83004709 GTGGGGATATACTTGGAGGAAGG - Intronic
1088540385 11:110907651-110907673 GTGGGTACATTATGGGAGCATGG + Intergenic
1088817056 11:113428586-113428608 GTGGAGAACTTCCTGGAGGAGGG + Intronic
1088866207 11:113850590-113850612 TCTGGAACCTTCTGGGAGGAAGG - Intronic
1089497334 11:118914303-118914325 ATGGGGCCATTGTGGGAGGATGG + Intronic
1089500154 11:118927205-118927227 CTGGGGACCATCTGTGAGGAGGG - Intronic
1089608555 11:119656517-119656539 GTGGGGGCTTTCAGGGATGAGGG + Intronic
1091172610 11:133531867-133531889 GTTGGGACCTGCAGGGTGGAAGG - Intronic
1091195565 11:133727995-133728017 GTGGGGACCATCTGGGACACTGG - Intergenic
1091602312 12:1925386-1925408 CTGGAAACCTCCTGGGAGGACGG + Intergenic
1091602340 12:1925486-1925508 CTGGAAACCTCCTGGGAGGATGG + Intergenic
1091602354 12:1925536-1925558 CTGGAAACCTCCTGGGAGGATGG + Intergenic
1091781954 12:3219467-3219489 AGGCGGACCTTCTGTGAGGATGG + Intronic
1091882889 12:3993833-3993855 GATGAGACTTTCTGGGAGGACGG - Intergenic
1092112854 12:5976208-5976230 GTGGGCCAGTTCTGGGAGGAGGG - Exonic
1092981476 12:13799223-13799245 GTGGGGACCTGCAGGGGGAAGGG - Intronic
1093012720 12:14126002-14126024 ATGGTGACCTCCTGAGAGGAGGG + Intergenic
1093647006 12:21598045-21598067 GTGTGTACGTTATGGGAGGAAGG + Intronic
1094796552 12:33979771-33979793 GTGGTTTCCTCCTGGGAGGAAGG + Intergenic
1095109109 12:38271758-38271780 GTGGTTTCCTCCTGGGAGGAAGG + Intergenic
1096110695 12:49027397-49027419 GTGGAGGCCTTTTGGGAGGGTGG - Intronic
1096177844 12:49534862-49534884 CTGGGGACCTCCAGAGAGGAAGG + Intergenic
1096298181 12:50401415-50401437 GCGGGGCCCCTCTGGGAGGGAGG + Intronic
1096561513 12:52439089-52439111 GTGGGGCCCTCCTCGAAGGAGGG + Intergenic
1097118718 12:56717421-56717443 GTGGGGCCCTCTTTGGAGGATGG + Intronic
1098567891 12:71956350-71956372 CTGAGGACCATCTGGGAGGTTGG + Intronic
1100356072 12:93831207-93831229 ATGGTGACCTCCTGGGAGCAGGG + Intronic
1100980470 12:100158630-100158652 ATGGTGACCTTCTGGGAGCAGGG - Intergenic
1102435853 12:112922588-112922610 GTGGTGGCCTCCTGGGAAGAGGG - Intronic
1102569778 12:113820434-113820456 GTGGGAGCCTGCAGGGAGGAAGG + Intronic
1104928625 12:132326913-132326935 GTGGGGCCCTACGGGGAGGGCGG - Intronic
1105362894 13:19737119-19737141 ATGGTGACCTTCTGGGAGCAGGG - Intronic
1105694998 13:22879266-22879288 ATGGTGACCTCCTGGGAGCAGGG - Intergenic
1106024547 13:25944600-25944622 ATGGTGACCTCCTGGGAGCAGGG + Intronic
1106449141 13:29864171-29864193 ATGGTGACCTCCTGGGAGCAGGG - Intergenic
1108238040 13:48429398-48429420 ATGGTGACCTCCTGGGAGCAGGG + Intronic
1108334791 13:49428525-49428547 GTGGGGGCCATCTTGGAGGCTGG + Intronic
1111931432 13:94516773-94516795 GTGAGGACCTTCTTGGTGGTGGG - Intergenic
1111942956 13:94632616-94632638 GTGGAGGCATTTTGGGAGGAGGG - Exonic
1112610298 13:100948766-100948788 GGGGGGATCTTGTGGGAGGAAGG - Intergenic
1112781193 13:102903050-102903072 GTAGGGACCTAGTGGGAGAATGG + Intergenic
1112828475 13:103419944-103419966 GTGGGGACCCTCTGGAAGAGGGG + Intergenic
1113356411 13:109585158-109585180 GTGGGGAGCTTATGTGGGGAGGG - Intergenic
1113643537 13:111975991-111976013 GTGGGCGCCTGCCGGGAGGAGGG + Intergenic
1114416920 14:22551109-22551131 CTGGGGACCCTGGGGGAGGAGGG - Intergenic
1117840564 14:59856515-59856537 GTGGGGACCAGCTGGAATGAGGG - Intronic
1118360996 14:65056400-65056422 GAGGGGACCTGCTGGGTTGAAGG + Intronic
1118457438 14:65957785-65957807 GTGGAGTCATTCTGGGAAGAGGG - Exonic
1118749153 14:68794062-68794084 GTGGGCTTTTTCTGGGAGGAAGG - Intronic
1119374061 14:74174590-74174612 ATGGTGACCTTATGGGAGCAGGG + Intronic
1121052710 14:90829968-90829990 GTGCACACATTCTGGGAGGAAGG - Intergenic
1122199910 14:100116218-100116240 GAGGGGACCCTCTGGAAAGAGGG + Intronic
1122413882 14:101539353-101539375 GTGGGCACCTCCTTGGGGGAGGG + Intergenic
1122871810 14:104642229-104642251 GCTGAGACTTTCTGGGAGGAAGG - Intergenic
1122887571 14:104717244-104717266 GTGGGGGCGGACTGGGAGGACGG - Intronic
1122887815 14:104718317-104718339 GTGGGGGCCGTCTGGGTGGCGGG + Intronic
1123056528 14:105573100-105573122 CTGGGAACCTTCTAGAAGGAGGG + Intergenic
1123057405 14:105578707-105578729 CTGGGAACCTTCTAGAAGGAGGG - Intergenic
1123080961 14:105693228-105693250 CTGGGAACCTTCTAGAAGGAGGG + Intergenic
1123081681 14:105698640-105698662 CTGGGAACCTTCTAGAAGGAGGG - Intergenic
1123117165 14:105899953-105899975 ATGGGGTCCAGCTGGGAGGAAGG + Intergenic
1123119249 14:105909263-105909285 ATGGGGTCCAGCTGGGAGGAAGG + Intergenic
1123121450 14:105918818-105918840 GTGGGTTCCAGCTGGGAGGAAGG + Intronic
1123661642 15:22569958-22569980 GCAGGGCCCTTCTGGGAGCAAGG + Intergenic
1123986634 15:25652260-25652282 GAGGGAACCTTCTGGGCTGATGG + Intergenic
1124262560 15:28205551-28205573 GCAGGGCCCTTCTGGGAGCAAGG - Intronic
1124315441 15:28664191-28664213 GCAGGGCCCTTCTGGGAGCAAGG + Intergenic
1124441279 15:29687994-29688016 GCTGGGACTTCCTGGGAGGAAGG + Intergenic
1125052848 15:35321474-35321496 GTGGTTACCTTCTGGTAAGAGGG + Intronic
1125719919 15:41840357-41840379 GAGAGGAGCTTCTGGGTGGAAGG + Intronic
1126240071 15:46431623-46431645 GTGAGAACTTTCTGGGATGATGG + Intergenic
1126284629 15:46996832-46996854 CTGCGGAGCTCCTGGGAGGAGGG - Intergenic
1129038370 15:72664657-72664679 ATGGTGACCTCCTGGGAGCAGGG + Intronic
1129211520 15:74072574-74072596 ATGGTGACCTCCTGGGAGCAGGG - Intronic
1129398884 15:75268510-75268532 ATGGTGACCTCCTGGGAGCAGGG + Intronic
1129402492 15:75292786-75292808 ATGGTGACCTCCTGGGAGCAGGG + Intronic
1129709985 15:77815983-77816005 GTGGGGGCTTTCTAGGAAGATGG - Intronic
1129728638 15:77916849-77916871 ATGGTGACCTCCTGGGAGCAGGG - Intergenic
1130028256 15:80288735-80288757 CTGGGGACTTTGTGTGAGGATGG - Intergenic
1130576114 15:85094671-85094693 GAGGGGACCAACGGGGAGGAAGG - Intronic
1132243208 15:100276257-100276279 GTGGGTACCTGGTGGGAGGGTGG + Intronic
1132432596 15:101773380-101773402 ATGGTGACCTCCTGGGAGCAGGG - Intergenic
1132848640 16:2013313-2013335 TTGGTGACCTCCTGGGAGCAGGG + Intronic
1133036990 16:3039042-3039064 CTGTGAACCTTCTGGGAGTAGGG - Intergenic
1133371551 16:5249239-5249261 CTGGGGGCCTTCAGGAAGGATGG + Intergenic
1133549933 16:6844351-6844373 GTGGGGATCTGCTGAGGGGAAGG - Intronic
1133929651 16:10221919-10221941 ATGGTGACCTCCTGGGAGCAGGG - Intergenic
1134387503 16:13787526-13787548 GTGGTTACCTTCGGGAAGGAGGG + Intergenic
1135091194 16:19519232-19519254 GTGGGGTCCCTCTCTGAGGAGGG + Intronic
1135590364 16:23700828-23700850 CTGGGGAGCTGCTGGGAGGGAGG + Intronic
1135890149 16:26349656-26349678 GTGAGGCCATCCTGGGAGGAAGG + Intergenic
1136006937 16:27337186-27337208 GTGGAGCCCTGCTGGGGGGAGGG + Intronic
1137559292 16:49492638-49492660 GTGGGCATCTGCTGGGAGGCAGG - Intronic
1137635039 16:49978494-49978516 GGAGGGCCCTACTGGGAGGATGG - Intergenic
1138703262 16:58887411-58887433 GTGGGAACCTTTTGGGGTGATGG + Intergenic
1140285554 16:73599476-73599498 GTGGGGCCCTTCTGGGCACAGGG + Intergenic
1140840092 16:78830532-78830554 CTGGGAATCTGCTGGGAGGAAGG - Intronic
1141003816 16:80333636-80333658 GTGGCCACCTCCTGGCAGGAAGG + Intergenic
1141524679 16:84603981-84604003 GTGGGGGCCATCAGGGAGGGAGG - Intronic
1142029134 16:87829735-87829757 GTGGAGACCACCGGGGAGGAGGG - Intergenic
1142287522 16:89177466-89177488 GAGGGGGCCTCCAGGGAGGAGGG + Intronic
1142321472 16:89385905-89385927 GTGGTGACCTCCTGGGAGTGGGG - Intronic
1142389844 16:89792134-89792156 GTGGCCACCGGCTGGGAGGAAGG - Intronic
1143249391 17:5511618-5511640 GTGAGGACTTGCTGGGATGAGGG + Intronic
1143253520 17:5539382-5539404 GTGGGTCCCTTCTGGGCAGAGGG - Intronic
1143801502 17:9386440-9386462 GAGGAAACTTTCTGGGAGGATGG + Intronic
1143822448 17:9575740-9575762 GGAGGGACCTTCGGGGAGGCCGG - Intronic
1144465077 17:15490672-15490694 TTCGGGAGCTTCTGGGTGGAGGG + Intronic
1146267991 17:31465667-31465689 ATGGTGACCTCCTGGGAGCAGGG + Intronic
1146518363 17:33507263-33507285 GTGGGCCCTCTCTGGGAGGAAGG - Intronic
1147258910 17:39197437-39197459 ATGGGGATCTCCTGGGAGGGTGG + Exonic
1147572485 17:41579949-41579971 GTGGGGAAATCCCGGGAGGAGGG + Intergenic
1148690078 17:49522010-49522032 GTGGGGAGCTCAGGGGAGGAGGG + Intergenic
1148853764 17:50567464-50567486 GCTGGGACCAGCTGGGAGGAAGG + Intronic
1150458633 17:65328561-65328583 TTGGGGACCATCTTGGAGGCTGG - Intergenic
1151209890 17:72536669-72536691 GTGGGGACATTGGGGGAGGACGG + Intergenic
1151699997 17:75737814-75737836 GTGGGGACCGTGGTGGAGGATGG - Intronic
1151719294 17:75846474-75846496 CTGGGGCTCTTCTGGGAGCACGG - Exonic
1151920045 17:77147757-77147779 CAGGGAACCTTCTGGGGGGATGG + Intronic
1152374522 17:79912317-79912339 GTGGTGACCTTGTAAGAGGAGGG - Intergenic
1152389202 17:79992735-79992757 GTGGGAATGTTCTGGAAGGAGGG - Intronic
1152504713 17:80741275-80741297 GTGGGGGCCTTCCGAGTGGAGGG + Intronic
1152505688 17:80748156-80748178 GTGAGGACCTGTTGGGTGGATGG + Intronic
1152607772 17:81301674-81301696 CTGGGCACCGTCTGGGAAGAGGG + Intergenic
1152645436 17:81466531-81466553 GTGGGGTCCCTCCAGGAGGAGGG + Intergenic
1152861813 17:82700802-82700824 GTGAGGACCTTCTGTGGGGCAGG - Intergenic
1153538332 18:6127845-6127867 ATGGTGAACTTCTGGGAGGGTGG - Intronic
1153940290 18:9970824-9970846 GTGTGGTCATTCTTGGAGGACGG - Intergenic
1155671427 18:28376628-28376650 GTGGGGAGCTAGTGGCAGGAGGG - Intergenic
1156354831 18:36331991-36332013 GAGGGCACCTTCTGGGTGTAAGG + Intronic
1157406767 18:47428278-47428300 GCTGGGACTTTTTGGGAGGAGGG + Intergenic
1157804681 18:50649393-50649415 GTGCAAACCTTCTGGGTGGAAGG - Intronic
1159504867 18:69323034-69323056 GAGGGAACCTTCTGGGGAGATGG + Intergenic
1159868160 18:73730379-73730401 GAGAGGACCTCCTGGTAGGAAGG - Intergenic
1160317077 18:77858433-77858455 CTGGGGACCCTCTGGGATGGGGG + Intergenic
1160764044 19:799165-799187 CTGGGGTCCTGCTGGGAGGGAGG + Intronic
1161119886 19:2519717-2519739 CTGGGGTCCTTCCAGGAGGAGGG + Intronic
1161297220 19:3526198-3526220 GTGGGGGCCTGCAGGGCGGATGG - Intronic
1161469331 19:4448405-4448427 GTGGAGAAGTGCTGGGAGGAGGG + Exonic
1161987108 19:7662001-7662023 GGGAGGGCCTTCTGGGTGGAGGG - Intergenic
1162017293 19:7852458-7852480 GAGGGGACCTTCGTGGGGGAAGG - Intronic
1162892903 19:13746940-13746962 GTTTGGGGCTTCTGGGAGGATGG + Intronic
1163083212 19:14958473-14958495 GTGGGGACCTCTTGGGAAGGTGG + Intronic
1163760250 19:19132602-19132624 GTGGAGACCTTCAGGGCTGAGGG + Intronic
1165362509 19:35345612-35345634 GTGGGGGCCTTCAGAGAGGGGGG - Exonic
1165567366 19:36742442-36742464 GAGGGGACTTTTTGGGATGATGG + Intronic
1165668685 19:37655875-37655897 CTGGGGCCCTTCAGGGAGCAAGG + Intronic
1165849366 19:38840366-38840388 GTGGGGCCCTCCTGGGGGGTGGG + Exonic
1166084757 19:40467331-40467353 GTGGGGACATACTTGGGGGAGGG - Intronic
1166341246 19:42138577-42138599 GTGGGGACCGGCTGGTAGCATGG + Intronic
1166562831 19:43744716-43744738 GTGGGCACCCACTGGGAGCAGGG - Intronic
1166842914 19:45709875-45709897 GTGTAGTGCTTCTGGGAGGAAGG + Intergenic
1167643527 19:50694557-50694579 TAGGGGGCCTGCTGGGAGGAAGG + Intronic
1167693985 19:51003328-51003350 CTGGGGCCTTTCTGGGAGGGAGG - Intronic
925051479 2:819159-819181 GTGAGGACCTTCCTGGGGGATGG - Intergenic
925913935 2:8590810-8590832 GTGGGGAATTTCTGGGTGGATGG - Intergenic
926240145 2:11079102-11079124 GTGGGGAGCTGTTGTGAGGAGGG + Intergenic
927434824 2:23058016-23058038 GTGGGGAGCTTCTGGGAGAGGGG + Intergenic
927809680 2:26174022-26174044 GAGGGGACCGTTTGGGGGGAGGG + Intronic
928398291 2:30959946-30959968 GAAGGGTCCTCCTGGGAGGAGGG - Intronic
929562594 2:42965038-42965060 GTGGGGACTTTCTGACAGCAAGG + Intergenic
929940247 2:46328218-46328240 GGGGGCACCTCCTGGAAGGAGGG + Intronic
931126098 2:59278585-59278607 CTGGGAACTTTCTGGGATGATGG - Intergenic
931431468 2:62212158-62212180 AAGGGGACCTTGTAGGAGGAAGG + Intronic
932132132 2:69197264-69197286 GTGGCTACCTACTGGGAGCAGGG - Intronic
932422538 2:71609870-71609892 TTGGGTTCCTTCTGCGAGGATGG - Intronic
933414366 2:81967211-81967233 ATGGTGACATTCTGGGAGTAGGG + Intergenic
934518364 2:95003689-95003711 ATGGTGACCTCCTGGGAGCAGGG - Intergenic
934663935 2:96157474-96157496 ATGGGGGCCTCCTGGGGGGACGG - Intergenic
937134016 2:119536793-119536815 GTGGGGAGTCTCTGGGAGGTGGG - Intergenic
937277341 2:120693457-120693479 GTGGGGTCCTTCTTGGTGCATGG - Intergenic
937983112 2:127626446-127626468 GTGGGGACCCTTTAGGAGGAGGG - Intronic
938145394 2:128830672-128830694 GTGGGGCCTTTCTGGGGGCAGGG + Intergenic
938244028 2:129763675-129763697 CTGGGCACCATCTGGGTGGAAGG + Intergenic
941344297 2:164348414-164348436 GTGGGGGCCTTGTGGGAGATGGG + Intergenic
942501072 2:176591717-176591739 GTGGGGACCTCAGGTGAGGATGG + Intergenic
944691308 2:202160945-202160967 TTAGGGAGCTGCTGGGAGGATGG - Intronic
946347711 2:219124556-219124578 GTGAGGACCATGTGTGAGGAGGG - Intronic
946644835 2:221822165-221822187 GAGGGGACTTTTTGGGATGATGG - Intergenic
947135480 2:226973078-226973100 GGGAGGAACTTCTGTGAGGAAGG - Intronic
948056949 2:235015751-235015773 GTGTGAACCATCTGGGAGGCTGG + Intronic
948610105 2:239161645-239161667 CTGGGGACCTTCAGGCTGGAGGG - Intronic
948834785 2:240620657-240620679 GTGGGGACCCCCTGTGGGGATGG + Intronic
1169548804 20:6679902-6679924 GCGGGGACCTGTTGGGTGGATGG - Intergenic
1169975867 20:11327155-11327177 TTGGGGAACTTCTGGAATGATGG + Intergenic
1171014226 20:21525206-21525228 GCGGGGAGCTTCGTGGAGGAAGG - Intergenic
1171956056 20:31464680-31464702 ATGGGGAAATTTTGGGAGGAAGG - Intergenic
1172033371 20:31996344-31996366 GTGGGGAAGGTCTGGGAGGTGGG - Intronic
1172946447 20:38693177-38693199 CTGGGGGCCTGCTGGGAGGAGGG - Intergenic
1173186735 20:40846081-40846103 TTGGGGACCATCTTGGAGGATGG + Intergenic
1173240350 20:41290424-41290446 ATGGTGACCTCCTGGGAGCAGGG - Intronic
1173764535 20:45595646-45595668 GAGAGGACCTCCTAGGAGGAGGG - Intergenic
1174067341 20:47875064-47875086 GGGGGCACATTCTAGGAGGAGGG + Intergenic
1175249264 20:57598957-57598979 GTGTGGACCTTCTGTGACAAGGG - Intergenic
1175286375 20:57839614-57839636 GTGGGGTCCCTGTGGGAGAAAGG - Intergenic
1175417899 20:58813617-58813639 GTGGGGACATTCTGGGATGAAGG - Intergenic
1175476180 20:59276312-59276334 GTGGTGATTTTCTGGGAAGAAGG + Intergenic
1176109303 20:63404268-63404290 GTGGGGCCATACTGGGAGGGAGG + Intergenic
1176145945 20:63565544-63565566 ATGGTGACCGTCGGGGAGGACGG - Exonic
1177828868 21:26114298-26114320 TTGGGGGCCTTCTTGGAGGCTGG - Intronic
1178901874 21:36605160-36605182 GTGGGGGCATTCTCAGAGGAGGG - Intergenic
1179932468 21:44579572-44579594 GTGGGCCCCTGCTGGGAGGCAGG + Exonic
1180655766 22:17419218-17419240 CGCGGGAGCTTCTGGGAGGAGGG - Intronic
1181064056 22:20297369-20297391 GTGGGGACCCTCTGCCAGCAGGG - Intergenic
1182534429 22:30989948-30989970 GTGAGGCCCTTCTGGGAGCAGGG + Intergenic
1182622338 22:31624997-31625019 CTGGGGACGTTCTGAGTGGATGG - Intronic
1183033129 22:35120328-35120350 GTGGGGGGCTTCTGGGAGGCTGG - Intergenic
1183101459 22:35586683-35586705 CTGGGGACCCTCTGGGAGGCTGG - Intergenic
1183460547 22:37947351-37947373 GTGGGGACGGGCTGCGAGGATGG + Exonic
1183550770 22:38482892-38482914 GTTGGGACATTCTAAGAGGAGGG - Intronic
1183818410 22:40323204-40323226 CTGGTGACCTTCTGGGAGGAGGG + Exonic
1183829555 22:40410527-40410549 GTGGAGAGCTCCTGGCAGGAAGG + Exonic
1184115138 22:42417783-42417805 GTGAGGACCATGGGGGAGGAGGG + Intronic
1184299820 22:43551218-43551240 CTGGGGACCTTCTTGGTCGAAGG - Intronic
1184620154 22:45671379-45671401 GGGAGGACATTCTGGGTGGAGGG - Intergenic
1184745415 22:46452968-46452990 GTGGGGACATTCAGGTGGGATGG + Intronic
1184784819 22:46666599-46666621 CTGGGGCCCTTCTGGGCAGAGGG - Intronic
1184901393 22:47448632-47448654 AGGGGGAGCTTCTGGGAGGTGGG - Intergenic
949505106 3:4720044-4720066 GAGGGAACTTTCTGGGATGATGG - Intronic
950256749 3:11512207-11512229 GTGGGGGACCTCTGGGAGGTAGG - Intronic
950475794 3:13214149-13214171 GTTGGGACCCTTTGGCAGGAGGG - Intergenic
950740965 3:15051685-15051707 TTGGGGCCCTGCTGGGGGGATGG - Exonic
951540819 3:23780281-23780303 GTGGGGCTGTTCTGGGAGGCAGG - Intergenic
951983749 3:28594793-28594815 TTGGGGGCCTTCTTGGAGGTGGG + Intergenic
952675962 3:36030553-36030575 ATGTGGAACTTCTGGGAGGGTGG - Intergenic
952888944 3:38028740-38028762 CTGGAGGCCTTCTGGGAGGCGGG - Intronic
953237879 3:41121830-41121852 GTGGAGGACTACTGGGAGGAGGG + Intergenic
954569814 3:51631301-51631323 GGGGGGACTTTCTGGTATGAGGG + Intronic
954742576 3:52765733-52765755 GTGGGTCCCTTCTGTGGGGAAGG - Intronic
957282302 3:78169440-78169462 GTGAAGACATTCTAGGAGGAGGG - Intergenic
960672198 3:120164944-120164966 GTGGTGGCATGCTGGGAGGAAGG + Intronic
962404407 3:135088190-135088212 GTGGGGACATTCTGTAACGATGG - Intronic
962807066 3:138935541-138935563 ATGGTTACCTTGTGGGAGGAGGG + Intergenic
964115741 3:153134368-153134390 ATGGTGACCTTCTGGGAGCAAGG - Intergenic
964131962 3:153299266-153299288 GTGGGGGGCTGGTGGGAGGAGGG + Intergenic
966508731 3:180736548-180736570 ATGGTGACCTACTGGGAGGCGGG - Intronic
967790884 3:193547766-193547788 GTAGGGACCTTCTGAGCGTAGGG - Intronic
968534043 4:1112873-1112895 GTGGGGGGCTGCAGGGAGGAAGG - Intronic
968711453 4:2122362-2122384 AAGGACACCTTCTGGGAGGAGGG + Intronic
968817387 4:2829102-2829124 GAGGGGAGCAGCTGGGAGGAAGG - Intronic
969438454 4:7202095-7202117 GTGGGAACCTGCTGGGAGCGGGG - Intronic
970415323 4:15851061-15851083 GTGGAGACCTTAGGGGAGGGTGG + Exonic
970422934 4:15921862-15921884 GTGGGGACTCTCTTGGTGGATGG - Intergenic
971910670 4:32792985-32793007 GTGGGGAACTTCAGGGAAGGTGG - Intergenic
972184676 4:36514086-36514108 GTATGAACCTTTTGGGAGGAAGG - Intergenic
972702418 4:41507196-41507218 GTGTGGAGGTGCTGGGAGGATGG - Intronic
974034513 4:56805966-56805988 ATGGTGACCTCCTGGGAGCAGGG + Intergenic
977119059 4:93073780-93073802 GTTGGCACATTCTGGGAGGCAGG + Intronic
978150231 4:105426029-105426051 GGGGGAACTTTCTGGGATGATGG + Intronic
981580646 4:146245554-146245576 TTGTGGCCCTTCTGGGAGGGAGG + Intergenic
982213639 4:153061460-153061482 CTGGGGCCTTTCTGGGAGGTGGG + Intergenic
984865760 4:184279069-184279091 ATGGTGACCTTCTGGGAGTGGGG + Intergenic
986305155 5:6509051-6509073 GTGGTGACCTTCACAGAGGAAGG - Intergenic
987113310 5:14707383-14707405 TTGGGGATCTTCTGGAGGGAAGG - Exonic
989144791 5:38238159-38238181 GAAGGGACCATCTTGGAGGAAGG - Intergenic
990310540 5:54533882-54533904 GTGGAGACCAACAGGGAGGAAGG + Intronic
991102846 5:62812201-62812223 GTGGGAGCCTTCTTGAAGGATGG - Intergenic
992193641 5:74318118-74318140 ATGGTGACCTCCTGGGAGCAAGG + Intergenic
992738487 5:79748289-79748311 GTGGGGAATTACTGGGACGAAGG - Intronic
995957552 5:117796360-117796382 GAGGGGACCATCTAGAAGGAGGG - Intergenic
997466476 5:134091291-134091313 GTGGTAACCTTCAGTGAGGAAGG - Intergenic
997520118 5:134517934-134517956 ATGGTGACCTCCTGGGAGCAGGG + Intergenic
1000335021 5:160235687-160235709 CTGGAGAGCTTCAGGGAGGAGGG - Intronic
1002052589 5:176579720-176579742 GTGGAGACTGGCTGGGAGGAAGG + Intronic
1002189134 5:177469791-177469813 CTGAGGACCCTCTGGGAGGGAGG + Intronic
1002323466 5:178389529-178389551 GTGGGCACCCTCTGTGAGGAGGG - Intronic
1002338727 5:178500061-178500083 GTGGGGAGGTACAGGGAGGAAGG + Intronic
1002372377 5:178765616-178765638 GAGGGTACCTTCTGGGATGCAGG - Intergenic
1002584332 5:180232571-180232593 GTGGGGGTTTTCAGGGAGGAGGG - Intergenic
1003271585 6:4612501-4612523 GTTGGTTCCTTCTGGAAGGAAGG - Intergenic
1004760849 6:18664433-18664455 CTGGGGACCTTCTGGTCTGAGGG - Intergenic
1005351683 6:24941991-24942013 GGGGTCACATTCTGGGAGGAAGG - Intronic
1005631556 6:27712813-27712835 GTGGGGCTCTTCTGGGTGCAGGG + Intergenic
1005941191 6:30561570-30561592 GTGGTTACCTTTGGGGAGGAGGG + Intronic
1006835735 6:36997824-36997846 GAAGGGACCTGGTGGGAGGAGGG + Intergenic
1007598998 6:43070265-43070287 GTTGGGCCCTGCTGGGAGGTGGG + Intronic
1007725667 6:43914323-43914345 CTGGGGATTTTCTGGGAGCAGGG - Intergenic
1011439660 6:87374090-87374112 ATGGGAATCTTCTGGGATGACGG + Intronic
1011486338 6:87845782-87845804 ATGGTGACCTCCTGGGAGCAGGG + Intergenic
1011764503 6:90605724-90605746 GAGGGAACTTTCTGGGATGATGG - Intergenic
1013411737 6:109889394-109889416 GAGGGGAGGCTCTGGGAGGAGGG + Intergenic
1015521262 6:134133704-134133726 TTGGTGACCTCCTGGGAGCAAGG + Intergenic
1017246214 6:152228644-152228666 GTGAGGACCTTCTGGTTGCATGG - Intronic
1017723227 6:157258828-157258850 CTGGGGACCCTCTGGCTGGATGG + Intergenic
1018810055 6:167292770-167292792 GTGTGCACTTTCTGGAAGGAGGG + Intronic
1019037182 6:169071505-169071527 GGGGTCACCTTCTGGAAGGAAGG - Intergenic
1019291660 7:253535-253557 GTGGGGGCTTTCTGGGAGGAAGG - Intronic
1019425066 7:971085-971107 GTGGGGGCCTCATGGGATGATGG - Intronic
1021276999 7:18663829-18663851 GAGGGGAGCTTGTGGGAAGAAGG - Intronic
1022435980 7:30385534-30385556 GTGGGGGCCTAATGGGAGGTGGG - Intronic
1023112323 7:36826386-36826408 TTGGGTACCATCTGGGAGGCTGG - Intergenic
1023595268 7:41822866-41822888 ATGGGTTCCCTCTGGGAGGATGG - Intergenic
1024477345 7:49827983-49828005 GAGGGCACATTCTGGGATGATGG - Intronic
1024565927 7:50680927-50680949 ATTGGGATCTTCTTGGAGGAGGG - Intronic
1025823733 7:64994457-64994479 GAGGGGAGGCTCTGGGAGGAGGG + Intronic
1026026749 7:66751632-66751654 GTGGGTACCTGCTAGGAGTAAGG - Intronic
1026859786 7:73778361-73778383 CTGGGGACTTTCTTGGGGGATGG - Intergenic
1027824983 7:83100639-83100661 CAGGGGACCTTTTTGGAGGATGG + Intronic
1029366296 7:100118751-100118773 GTGGGGCCGTGCTGGAAGGATGG + Intronic
1029497760 7:100906434-100906456 GTAGGGACCTCCTGGGAGCGGGG - Intergenic
1032096318 7:128939975-128939997 GAAGGGAGCTTCTAGGAGGATGG + Intronic
1032269145 7:130387925-130387947 GTGGGGATGATCTGGGAGGCTGG - Exonic
1032529740 7:132610244-132610266 CTGGGGAATTTCTGGGAAGATGG + Intronic
1033362256 7:140645960-140645982 ATGGTGACCTCCTGGGAGCAAGG + Intronic
1033781473 7:144675344-144675366 GTAGGAACTTTCTGGGATGATGG + Intronic
1034200442 7:149280398-149280420 GTGGGGGCCTTTTGGGAGTGGGG + Intronic
1034332354 7:150293851-150293873 GCTGCGACCTTCTGGGATGAAGG - Intronic
1034414079 7:150955829-150955851 GTGGGGACCTGGTAGAAGGAGGG - Intronic
1034578785 7:152025333-152025355 GTGGTGACCTCCCGGGAGCAGGG - Intergenic
1034665683 7:152816027-152816049 GCTGCGACCTTCTGGGATGAAGG + Intronic
1035029193 7:155846352-155846374 GGGGGAGCATTCTGGGAGGAGGG + Intergenic
1035140261 7:156752572-156752594 GAGGGGAGCTGCAGGGAGGAGGG + Intronic
1035303863 7:157917116-157917138 GTGGGGACCTTCAGCCAGGGAGG - Intronic
1036459135 8:8936433-8936455 GCAAGAACCTTCTGGGAGGAAGG - Intergenic
1036514280 8:9429414-9429436 CTGGGAACCTTCTGGGTGAAGGG + Intergenic
1036534481 8:9633508-9633530 TTGGGCACCTTCTTGGAGGCTGG - Intronic
1037396274 8:18447263-18447285 GGAGGCACATTCTGGGAGGAAGG - Intergenic
1037765480 8:21769877-21769899 CTGTGGTCCTTCTTGGAGGATGG - Intronic
1038507803 8:28100873-28100895 CTGGGGACCATATGGTAGGAGGG - Intronic
1038509629 8:28119717-28119739 GTGGGAACTTTCTGGGATGACGG - Intronic
1038582046 8:28756235-28756257 GTGGGGACTGACTAGGAGGAAGG - Intergenic
1039885422 8:41651440-41651462 GTGGGAGCCTGCTGGGAAGAGGG + Intergenic
1041103632 8:54420600-54420622 ATGGTGACCTTCTGGGAGCAGGG + Intergenic
1043529689 8:81135570-81135592 CTGGGGACATTCTGGGAGGCGGG - Intergenic
1045275618 8:100702237-100702259 GTGGGGTTCTTTTAGGAGGATGG - Intronic
1045382067 8:101637069-101637091 CTGGGGACCATCTGGGAGGGAGG + Intronic
1045412708 8:101934569-101934591 GTCGGGAGCTTCAGGAAGGAGGG + Intronic
1046806879 8:118488488-118488510 GGGGAAACCTTCTGGGATGATGG - Intronic
1047175853 8:122539765-122539787 GTGGTGGCCTTCTTGGAGGCTGG - Intergenic
1047226094 8:122956469-122956491 TTAGGGAGCTTCTTGGAGGAAGG + Intronic
1048109687 8:131454198-131454220 GTGGGGTCCTGGTGGGAGCAAGG - Intergenic
1048947960 8:139467842-139467864 GAGAGGACATTCTGGGAGGTGGG - Intergenic
1049181253 8:141223689-141223711 GCGGGGGCCTCCTGGGTGGATGG - Intronic
1049408129 8:142460709-142460731 GGAGGTACCTTCAGGGAGGAGGG - Intronic
1051438092 9:17054038-17054060 ATGGGGACCTTCTGGGGGAGTGG + Intergenic
1051936234 9:22446697-22446719 GTGGGGACCTTCTGGGAGGAGGG - Intergenic
1053474233 9:38370460-38370482 GTGAGGGGCTTCTGGGAGGGAGG + Intergenic
1054924888 9:70579307-70579329 GTAGTGACCTCCTGGGAGGGAGG - Intronic
1055755886 9:79556831-79556853 GTAAGAACCTTCTAGGAGGAGGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057220955 9:93257460-93257482 CTGGGGTCCTTCAGGGAGGGCGG + Intronic
1057918747 9:99078872-99078894 GTGGGTACCTCCTGGGAGAAGGG + Intergenic
1059396100 9:114035060-114035082 GTGGGGAGCATCCGAGAGGAAGG - Intronic
1059437084 9:114283525-114283547 GTGGGGAACTCCAGGGAGGAGGG + Intronic
1059540538 9:115125941-115125963 CTGGGAAGGTTCTGGGAGGAGGG + Intergenic
1060525718 9:124320251-124320273 GGGGGGACCTGGTGAGAGGATGG + Intronic
1060553461 9:124496544-124496566 GAGGGGCCCTGCTGGGAGGGAGG - Intronic
1061575503 9:131503439-131503461 GATGGGACCTTTTGGGACGAAGG + Intronic
1061885331 9:133588320-133588342 GTGGGGCCCTTCTGTCAGGAAGG + Intergenic
1061886268 9:133592487-133592509 GTGGGCACCTTCCTGGAAGAGGG - Intergenic
1061975432 9:134066121-134066143 GTTGGGACATCCGGGGAGGAGGG - Intronic
1062567758 9:137170829-137170851 GTGAGGGCCTGCAGGGAGGACGG + Intronic
1185967146 X:4619466-4619488 GTGTGGACCTGCTTGGAGAAGGG + Intergenic
1186469113 X:9807419-9807441 GAGGGGACCTGTTGGGAGGCCGG + Intronic
1186645798 X:11506107-11506129 GTGGGAGACTTCAGGGAGGAGGG - Intronic
1190244755 X:48683858-48683880 GTGGGGGCCCAATGGGAGGAAGG + Exonic
1190816177 X:53931695-53931717 GTGGGAACTTTCTGGGATTATGG + Intergenic
1192218086 X:69177809-69177831 GGGGAGACCCTATGGGAGGAGGG - Intergenic
1193083513 X:77427987-77428009 GTGGAGAACATCTGGGAAGATGG - Intergenic
1194651220 X:96516857-96516879 TTGGGGACCCTCTTGGAGGCTGG - Intergenic
1194726417 X:97403061-97403083 GTGAGGCCCTTCTGAGAGCAGGG + Intronic
1195697040 X:107674711-107674733 GATGGGACCTTTTGGGAGGGTGG + Intergenic
1196758106 X:119175840-119175862 ATGGGGAGCTTATGGGGGGAAGG - Intergenic
1197251989 X:124226317-124226339 GTGGGGACATTCTGGATGGGTGG + Intronic
1197378950 X:125714714-125714736 ATGTGGAACTTCTGGGAAGATGG + Intergenic
1197724519 X:129767776-129767798 GTGTGGACCCTCCTGGAGGAGGG - Intronic
1198416436 X:136424662-136424684 GGGGGAGCCTTCTGGGAGGCCGG + Intergenic
1199040496 X:143110179-143110201 GTTGTCACCTTCTGGGAAGAAGG + Intergenic
1200133200 X:153862524-153862546 GTGGGGACCGGGTGGTAGGAAGG + Exonic
1200884126 Y:8252182-8252204 CTGGGAACGTTCTTGGAGGAAGG + Intergenic