ID: 1051939098

View in Genome Browser
Species Human (GRCh38)
Location 9:22483272-22483294
Sequence TGGAATATGATTAAGGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051939098_1051939103 24 Left 1051939098 9:22483272-22483294 CCTTACTCCTTAATCATATTCCA No data
Right 1051939103 9:22483319-22483341 AGAAACAAATTTCTGTCCCAGGG No data
1051939098_1051939102 23 Left 1051939098 9:22483272-22483294 CCTTACTCCTTAATCATATTCCA No data
Right 1051939102 9:22483318-22483340 GAGAAACAAATTTCTGTCCCAGG No data
1051939098_1051939101 1 Left 1051939098 9:22483272-22483294 CCTTACTCCTTAATCATATTCCA No data
Right 1051939101 9:22483296-22483318 AAATATTTTGAGTTTAGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051939098 Original CRISPR TGGAATATGATTAAGGAGTA AGG (reversed) Intergenic
No off target data available for this crispr