ID: 1051939101 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:22483296-22483318 |
| Sequence | AAATATTTTGAGTTTAGACT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1051939099_1051939101 | -6 | Left | 1051939099 | 9:22483279-22483301 | CCTTAATCATATTCCAGAAATAT | No data | ||
| Right | 1051939101 | 9:22483296-22483318 | AAATATTTTGAGTTTAGACTTGG | No data | ||||
| 1051939098_1051939101 | 1 | Left | 1051939098 | 9:22483272-22483294 | CCTTACTCCTTAATCATATTCCA | No data | ||
| Right | 1051939101 | 9:22483296-22483318 | AAATATTTTGAGTTTAGACTTGG | No data | ||||
| 1051939097_1051939101 | 26 | Left | 1051939097 | 9:22483247-22483269 | CCATGTTTATTGCTTGGAGGAAT | No data | ||
| Right | 1051939101 | 9:22483296-22483318 | AAATATTTTGAGTTTAGACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1051939101 | Original CRISPR | AAATATTTTGAGTTTAGACT TGG | Intergenic | ||