ID: 1051939101

View in Genome Browser
Species Human (GRCh38)
Location 9:22483296-22483318
Sequence AAATATTTTGAGTTTAGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051939099_1051939101 -6 Left 1051939099 9:22483279-22483301 CCTTAATCATATTCCAGAAATAT No data
Right 1051939101 9:22483296-22483318 AAATATTTTGAGTTTAGACTTGG No data
1051939098_1051939101 1 Left 1051939098 9:22483272-22483294 CCTTACTCCTTAATCATATTCCA No data
Right 1051939101 9:22483296-22483318 AAATATTTTGAGTTTAGACTTGG No data
1051939097_1051939101 26 Left 1051939097 9:22483247-22483269 CCATGTTTATTGCTTGGAGGAAT No data
Right 1051939101 9:22483296-22483318 AAATATTTTGAGTTTAGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051939101 Original CRISPR AAATATTTTGAGTTTAGACT TGG Intergenic