ID: 1051949090

View in Genome Browser
Species Human (GRCh38)
Location 9:22609082-22609104
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051949090_1051949099 26 Left 1051949090 9:22609082-22609104 CCCTGCCCCACATATTGGTTGGT No data
Right 1051949099 9:22609131-22609153 CAGCCATGGTAGAAAGACACTGG No data
1051949090_1051949095 0 Left 1051949090 9:22609082-22609104 CCCTGCCCCACATATTGGTTGGT No data
Right 1051949095 9:22609105-22609127 TTCACCAGATTCCAAAGTAGAGG No data
1051949090_1051949098 12 Left 1051949090 9:22609082-22609104 CCCTGCCCCACATATTGGTTGGT No data
Right 1051949098 9:22609117-22609139 CAAAGTAGAGGAAACAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051949090 Original CRISPR ACCAACCAATATGTGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr