ID: 1051949098

View in Genome Browser
Species Human (GRCh38)
Location 9:22609117-22609139
Sequence CAAAGTAGAGGAAACAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051949091_1051949098 11 Left 1051949091 9:22609083-22609105 CCTGCCCCACATATTGGTTGGTT No data
Right 1051949098 9:22609117-22609139 CAAAGTAGAGGAAACAGCCATGG No data
1051949092_1051949098 7 Left 1051949092 9:22609087-22609109 CCCCACATATTGGTTGGTTTCAC No data
Right 1051949098 9:22609117-22609139 CAAAGTAGAGGAAACAGCCATGG No data
1051949093_1051949098 6 Left 1051949093 9:22609088-22609110 CCCACATATTGGTTGGTTTCACC No data
Right 1051949098 9:22609117-22609139 CAAAGTAGAGGAAACAGCCATGG No data
1051949090_1051949098 12 Left 1051949090 9:22609082-22609104 CCCTGCCCCACATATTGGTTGGT No data
Right 1051949098 9:22609117-22609139 CAAAGTAGAGGAAACAGCCATGG No data
1051949094_1051949098 5 Left 1051949094 9:22609089-22609111 CCACATATTGGTTGGTTTCACCA No data
Right 1051949098 9:22609117-22609139 CAAAGTAGAGGAAACAGCCATGG No data
1051949088_1051949098 13 Left 1051949088 9:22609081-22609103 CCCCTGCCCCACATATTGGTTGG No data
Right 1051949098 9:22609117-22609139 CAAAGTAGAGGAAACAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051949098 Original CRISPR CAAAGTAGAGGAAACAGCCA TGG Intergenic
No off target data available for this crispr