ID: 1051949099

View in Genome Browser
Species Human (GRCh38)
Location 9:22609131-22609153
Sequence CAGCCATGGTAGAAAGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051949088_1051949099 27 Left 1051949088 9:22609081-22609103 CCCCTGCCCCACATATTGGTTGG No data
Right 1051949099 9:22609131-22609153 CAGCCATGGTAGAAAGACACTGG No data
1051949094_1051949099 19 Left 1051949094 9:22609089-22609111 CCACATATTGGTTGGTTTCACCA No data
Right 1051949099 9:22609131-22609153 CAGCCATGGTAGAAAGACACTGG No data
1051949091_1051949099 25 Left 1051949091 9:22609083-22609105 CCTGCCCCACATATTGGTTGGTT No data
Right 1051949099 9:22609131-22609153 CAGCCATGGTAGAAAGACACTGG No data
1051949096_1051949099 -1 Left 1051949096 9:22609109-22609131 CCAGATTCCAAAGTAGAGGAAAC No data
Right 1051949099 9:22609131-22609153 CAGCCATGGTAGAAAGACACTGG No data
1051949090_1051949099 26 Left 1051949090 9:22609082-22609104 CCCTGCCCCACATATTGGTTGGT No data
Right 1051949099 9:22609131-22609153 CAGCCATGGTAGAAAGACACTGG No data
1051949093_1051949099 20 Left 1051949093 9:22609088-22609110 CCCACATATTGGTTGGTTTCACC No data
Right 1051949099 9:22609131-22609153 CAGCCATGGTAGAAAGACACTGG No data
1051949097_1051949099 -8 Left 1051949097 9:22609116-22609138 CCAAAGTAGAGGAAACAGCCATG No data
Right 1051949099 9:22609131-22609153 CAGCCATGGTAGAAAGACACTGG No data
1051949092_1051949099 21 Left 1051949092 9:22609087-22609109 CCCCACATATTGGTTGGTTTCAC No data
Right 1051949099 9:22609131-22609153 CAGCCATGGTAGAAAGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051949099 Original CRISPR CAGCCATGGTAGAAAGACAC TGG Intergenic
No off target data available for this crispr